Labshake search
Citations for Origene Technologies :
601 - 639 of 639 citations for Recombinant Mouse Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 mg total membranes (see above) obtained from HeLa cells transiently transfected with either empty vector or untagged PARP12 (#SC112439, Origene) were used in ADP-ribosylation assays ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Genomics 2023Quote: Two biological replicates of HMLE cells were UV crosslinked and iCLIP was performed as previously described using anti-hnRNPM antibody (Origene).
-
bioRxiv - Molecular Biology 2023Quote: ... Short hairpin RNA (shRNA) knockdown (KD) cell lines were generated through lentiviral delivery of shRNA pools targeting CBX2 (Origene TL314173), CBX4 (Origene TL314171) ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were whether transfected with a pCMV6-Entry vector coding for icIL-1RA1 or a pCDNA3.1 empty vector (Origene, Rockville, USA) and incubated at 37 °C and 5% CO2 for 48 hours ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Immunology 2021Quote: ... scramble and CAI shRNA lentiviral supernatant were produced by transfection of 293T cells with packaging lentiviral plasmids and either scramble or CAI shRNA lentiviral vectors (Origene, TL510087) followed by concentrating with Lenti-X concentrator (Takara ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells cultured in triplicate at 50-70% confluency were transfected with specific pooled siRNA Oligo Duplex (Origene Technologies, Rockville, MD, USA) or control siRNA Duplex ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses were produced by transfecting HEK293T/17 cells with the pLenti-C-mGFP vector where SCXB has been inserted (OriGene, Rockville, MD) expressing Scx-GFP and two packaging plasmids33 (pCMV-dR8.2 ...
-
A mean-field approach for modeling the propagation of perturbations in biochemical reaction networksbioRxiv - Pharmacology and Toxicology 2021Quote: ... Chop mRNA levels in treated cells were measured using quantitative RT-PCR as previously described [28] using validated primers (OriGene, Cat # HP207450).
-
bioRxiv - Physiology 2021Quote: ... medium was replaced by serum-free OptiMEM and cells were transfected with Septin-7-specific shRNA constructs in retroviral pGFP-V-RS vectors (Origene, Cambridge, UK) using Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2020Quote: ... PTEN-depleted 22RV1 cells were generated following lentiviral transfection of HuSh-29 pre-designed PTEN shRNA pGFP-V-RS constructs (Origene, Rockville, MD, USA), and selected under puromycin selection pressure at a final concentration of 0.5 μg/ml ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell lines MDA-231-TL313602 stably expressing shCYP27A1 (29 mer shRNA constructs against hCYP27A1 in lentiviral GFP (cat# TL313602, Origene, Rockville, MD, USA): A ...
-
bioRxiv - Cell Biology 2020Quote: ... passage 1 of pHCEnC were transfected with 10 nM anti-SLC4A11 siRNA (CCGAAAGUACCUGAAGUUAAAGAACT) or scrambled siRNA (OriGene Technologies, Rockville, MD, USA) using Lipofectamine LTX (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... For each construct, 1 µg DNA (wt 2N4R tau, N167Q 2N4R tau, N368Q 2N4R tau or AEP (Origene clone no. RC200309)) was used ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Biochemistry 2023Quote: ... About 5 x 106 HEK-293T cells were transfected with 5 µg of the plasmid pCMV6-XL5 HSD2 (SC122552, OriGene Technologies, Inc., Rockville, MD, USA) using the Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected either with scramble SiRNA (10 nM) or MAS-1 SiRNA (10 nM) according to manufacturer’s instructions (Origene Technologies, Rockville, MD, USA). Two days after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...