Labshake search
Citations for Origene Technologies :
101 - 150 of 339 citations for Recombinant Mouse Ntrk2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 1 (NM_006855) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC201571), pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene ...
-
bioRxiv - Cancer Biology 2022Quote: HEK-293T cells were transfected with plasmids overexpressing TurboGFP-tagged PEX3 (OriGene Technologies, RG202031) and Myc-DDK-tagged PEX19 (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... The AKT2 complex was incubated with recombinant TFEB (TP760282, Origene) for 15 minutes at 37°C in the presence of 10 nm ATP (A1852-1VL ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the c17orf80 sequence (NM_001100621) amplified from a commercially available tagged ORF clone (OriGene; RC221916L3) and pDEST-pcDNA5-BirA-FLAG vectors (Couzens et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCYT1B (UniProt KB: Q811Q9) recombinant proteins were purchased from Origene. In bacterial expression plasmids for His6-tagged PCYT2β (Uniprot KB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant human NAT10 derived from 293T cells was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Cell Biology 2022Quote: ... A plasmid coding for expression of Flag-HA-mNeonGreen-tagged MmULK4 (cDNA: Origene, MR217918; mNeonGreen (mNG) was provided by Allele Biotechnology and Pharmaceuticals (Shaner et al ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... we obtained the WT mS29 gene as a Myc/DDK-tagged ORF from Origene (Cat# RC223182). Using restriction sites AsiSI and PmeI ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 0.25 µg recombinant SLP-76 (OriGene, Cat. TP721201) were then added to the sample and incubated at 30 °C for 60 min ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human glutaredoxin (Grx) transcript variant 1 was from Origene (cat# TP319385) (Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: ... Control HCT116 cells (WT) were established by transfecting pCMV6-AC-GFP Tagged Cloning Vector (Origene, Cat # PS100010) into HCT116 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Cancer Biology 2020Quote: Site-directed mutagenesis was performed using 50ng of KAT3A / CBP (CREBBP) (NM_004380) Human Tagged ORF Clone (OriGene) as the dsDNA template ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Cell Biology 2021Quote: Myc-DDK tagged Mnr (4933427D14Rik) cDNA in cloned in a pCMV6 plasmid was obtained from Origene (MR211309). hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Cell Biology 2023Quote: A Myc-DDK (FLAG)-tagged coding DNA sequence (CDS) clone of murine Runx2 was purchased from Origene within the pCMV-ENTRY overexpression vector (catalogue number MR227321) ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2023Quote: HCT116 TP53(-/-) cells were transfected with a FLAG-tagged RIG-I expression vector purchased from Origene (RC217615) using Lipofectamine 3000 in six 150 mm dishes plated to 90% confluency the day before ...
-
bioRxiv - Biochemistry 2023Quote: Myc-DDK-tagged lenti ORF clone of c1orf112 (Lenti-Myc-FLAG-RADIF) was obtained from Origene (RC211444L1). Human FIGNL1 sequence-verified cDNA (FIGNL1-cDNA ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and the recombinant Sin1 (also known as MAPKAP1, #TP311745) was purchased from Origene. For the knockdown experiments ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant Myc-Flag-RNF114 proteins were purchased from Origene (Origene Technologies Inc., TP309752) or were purified as described previously(Spradlin et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... A myc-DDK-tagged aromatase construct (pCMV6-myc-DDK-aromatase) was purchased from Origene (Rockville; Cat. No. MR224509); the pCAG-eGFP has previously been described (Srivastava et al. ...
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Cancer Biology 2019Quote: Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA). PITX1 ΔHD1 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SLC22A24 (NM_173586 and NM_001136506) tagged open reading frame (ORF) clone and vector control (pCMV6-Entry) were purchased from OriGene. These vectors were either transiently transfected or stably transfected into Flp-In™ 293 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...