Labshake search
Citations for Origene Technologies :
1 - 50 of 338 citations for Recombinant Mouse Chst3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Flag-tagged RNF114 was used as bait to precipitate pure recombinant p21 (Origene Technologies Inc. ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Csde1 ORF clone (Origene, MR210719, NM_144901, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag using AgeI/EcoRI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Gpr151 ORF clone (Origene, MR223707, NM_181543, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag with no any UTRs at AgeI/EcoRI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-tagged mouse VHL ORF Clone (Origene; Cat #MR201630) as templates to amplify human and mouse VHL ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Shox2 (Myc-DDK-tagged) and Control (Myc-DDK-tagged) were purchased from Origene. To transduce the ATDC5 cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene, CAT#: PS100020), KDELR3 transcript variant 2 (NM_016657 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: Myc-Flag-tagged SOX9 (PS100016 Origene) and 6x-HIS-tagged-HOXB2 (Addgene 8522 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral GFP tagged vector (Origene #100093) and human IL-1β (Origene #RC202079L4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Murine tagged Six2 (OriGene CAT# MG20410) and Six3 (OriGene CAT# MR204911 ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Biophysics 2023Quote: A Myc/DDK eptiope-tagged Pin1 (NM_006221) Human Tagged ORF Clone (Cat# RC202543) was obtained from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2018) E-cadherin deficient PDAC021T were transfected with human E-Cadherin mGFP-tagged Tagged ORF Clone Lentiviral Particle (Origene) at 25 multiplicity of infection (MOI) ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Neuroscience 2019Quote: ... GFP-tagged Kv4.2 (Cat# MG209597) and Myc-tagged Kv4.3 (Cat# MR221003) expression constructs were purchased from OriGene (Rockville, MD, USA).
-
bioRxiv - Cancer Biology 2019Quote: WM-46 cells stably transduced with FLAG-tagged KDELR3-001 (ENST00000216014) were transfected with GFP-tagged AMFR construct (Origene, RG209639) using FuGENE® HD transfection reagent as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Myc-DDK-tagged PEX19 (OriGene Technologies, RC201756) using Lipofectamine 2000 (Invitrogen ...
-
ANGPTL8 R59W variant influences inflammation through modulating NF-κB pathway under TNFα stimulationbioRxiv - Biochemistry 2023Quote: ... Myc tagged pCMV6 vector (OriGene, Rockville, MD, USA) was used as control for the transfection experiments ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2022Quote: ... DDK-MYC tagged RBFOX2 cDNAs were purchased from Origene in pCMV6-Entry vector (Cat ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids (Myc-tagged TSPO (‘TSPO-Myc’; catalogue # RC220107, OriGene) or a pCMV EV control (catalogue # PS100001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Immunology 2019Quote: pCMV6-Entry Tagged Cloning Vector was purchased from OriGene (#PS100001).
-
bioRxiv - Cell Biology 2021Quote: ... Myc- and DDK-tagged hemopexin plasmid was purchased from Origene. Glycosylation and cysteine mutations were made with the Quick Change II Site-Directed Mutagenesis kit (Promega) ...