Labshake search
Citations for Origene Technologies :
351 - 400 of 445 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV6-Entry containing the human SLC44A2 cDNA C-terminally fused to EGFP was purchased from OriGene. To introduce the rs2288904 SNP encoding a R154Q substitution ...
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mutant PES1 (#CW306514) and POLR2K (#CW306515) 3’UTR clones were all purchased from Origene. Mutant 3’UTR plasmids were generated by synthesizing 3’ UTR sequences in which the three GCCCCC seed matches in the 3’ UTR of PES1 and one in 3’ UTR of POLR2K was each changed to TGCAAA and this altered sequence was each inserted into the pmiRTarget construct by Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... The TissueScan™ Tissue qPCR Array containing cDNAs for human lymphoma I-II was purchased from Origene. Relative expression of Rictor was determined using inventoried Taqman probes and PCR master mix from Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Genetics 2023Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal neurons were treated at DIV 3 with AAV1mCherry-pU6-Kv2.1 shRNA designed by OriGene (target sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Neuroscience 2021Quote: ... hTGR5 gene was in pCMV6-Entry (GPBAR1 Human cDNA ORF Clone, NM_001077191; Origene Technologies, Inc., Rockville, MD, USA). The two plasmids were linearized with SalI (mDAT ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs encoding murine (pCMV-mDHCR7-Myc/DDK) and human DHCR7 (pCMV-hDHCR7-Myc/DDK) were purchased from Origene (MR223420 and RC228922 for murine and human cDNA clone respectively) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence of full length human WNK1 was derived from a commercial expression vector (#RC218208, Origene, USA). Expression constructs needed to generate biotinylated anti-GFP nanobody for native purification from human cells are available from Addgene (#149336 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... or with RhoGDI1 (ARHGDIA) Human siRNA Oligo Duplex (Locus ID 396) (SR300287 OriGene Technologies Inc., Rockville MD, USA) using Lipofectamine 3000 Transfection Reagent (L3000015 Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Microbiology 2021Quote: The open reading frame of human MIF was amplified by PCR from the vector pCMV6-entry MIF (Origene) and cloned into the pET11a vector (Novagen ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Genetics 2020Quote: The full-length human BBS2 clone in the pCMV6-entry vector was obtained commercially (Origene; Clone ID: RC204337). Using this as a template ...
-
bioRxiv - Cell Biology 2022Quote: ... Human ACLY(H760A) was generated by site-directed mutagenesis using the pCMV6-ACLY(MYC-FLAG) vector (Origene, RC200508). Human CPα (CAPZA1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A clone containing the consensus ADAMTS7 coding sequence (NM_014272 Human Untagged Clone) was purchased from Origene (Rockville, USA). To generate Gateway-compatible constructs ...
-
bioRxiv - Cancer Biology 2022Quote: The human KMT5C (NM_032701.4) open reading frame (ORF) was cloned from the pCMV6-Entry expression vector (Origene, RC203881) into the pLV-EF1a-IRES-Hygro lentiviral backbone (Addgene ...
-
bioRxiv - Microbiology 2020Quote: CD4+ 293T cells were transfected with 25 pmol of pooled siRNA (Origene, 3 siRNA per pool) with RNAiMax twice (on day 1 and 3) ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fifty FhNEJ per condition were washed 3 times in PBS and incubated with blocking solution (0.1% BSA in PBS) supplemented with 100 μg/ml of human PLG (Origene) for three hours at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...
-
bioRxiv - Cell Biology 2023Quote: ... The expression construct for human LIS1 (RefSeq: NM_000430) fused with a C-terminal FLAG epitope tag was obtained from OriGene. An iRFP670 expression plasmid (synthesised by Azenta Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: Human cryosections from the aorta of a 76-year-old male with atherosclerosis were purchased from OriGene (CAT#: CS611744). Sections were stained as above with minor alterations ...
-
bioRxiv - Cancer Biology 2024Quote: The pCMV6-AC-IGFBP2-GFP expression vector encoding human IGFBP2 (NM_000597) fused to the GFP in the C-terminal region was purchased from Origene Technologies (#RG202573) ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...