Labshake search
Citations for Origene Technologies :
101 - 150 of 510 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: 70% confluent HEK293T cells were transfected with Flag-tagged Mena in pcDNA3.1+/C-(K)DYK (obtained from Origene; Omu14068c) using calcium phosphate-based transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Immunology 2024Quote: ... with recombinant TSP-1 (Origene, USA) at a concentration of 100ng/ml ...
-
bioRxiv - Immunology 2019Quote: pCMV6-Entry Tagged Cloning Vector was purchased from OriGene (#PS100001).
-
bioRxiv - Neuroscience 2021Quote: ... mouse Csde1 ORF clone (Origene, MR210719, NM_144901, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag using AgeI/EcoRI restriction sites.
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Cell Biology 2021Quote: ... Myc- and DDK-tagged hemopexin plasmid was purchased from Origene. Glycosylation and cysteine mutations were made with the Quick Change II Site-Directed Mutagenesis kit (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Gpr151 ORF clone (Origene, MR223707, NM_181543, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag with no any UTRs at AgeI/EcoRI restriction sites ...
-
bioRxiv - Biophysics 2023Quote: ... flag-tagged mTHSD7A construct serving as the PCR template (Origene).
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-tagged mouse VHL ORF Clone (Origene; Cat #MR201630) as templates to amplify human and mouse VHL ...
-
bioRxiv - Cell Biology 2023Quote: FLAG-tagged wild type AMOTL2 (NM_016201) was obtained from Origene. Codon-optimized sequences encoding truncated ...
-
bioRxiv - Cell Biology 2024Quote: Myc-DDK-tagged ATP6V0A1 expression plasmid (RC226206, Origene, Rockville, MD) for ATP6V0A1 induction and pCMV6-Entry ...
-
bioRxiv - Cancer Biology 2022Quote: ... LSAMP stable transformants were established by transfecting COR-L279 cells with a tagged ORF clone of this gene (Origene; # RC207618) followed by 1mg/ml G418 selection (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein DHX36 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Myc-DDK-tagged ORF clone of MAFG (RC221486, OriGene USA) was a gift from I ...
-
bioRxiv - Neuroscience 2023Quote: ... The FLAG/Myc-tagged Zbtb7a construct was purchased from Origene (RC222759). The Zbtb7a shRNA (5’-GCCAGGAGAA GCACTTTAAG-3 ...
-
bioRxiv - Microbiology 2024Quote: Myc-tagged FOS (pCMV6-FOS) expressing vector was purchased from OriGene. The pBAH4 plasmid with point mutations in the ORF57 BS in FOS cDNA was generated by overlapping PCR using a set of primers with mutated BS (oBAH138 and oBAH139 ...
-
bioRxiv - Genetics 2019Quote: The (Myc-DDK-tagged)-CDK2 cDNA was obtained from Origene (Cat#RC200494). Y15F and Y15F mutant cDNA were generated as described above and transfected into HEK-293T cells (ATCC ...
-
bioRxiv - Cancer Biology 2020Quote: ... were transiently transfected with pCMV6 CMTM6 (Myc-DDK-tagged) (Origene, Cat #RC201061) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Cancer Biology 2021Quote: ... by stable transfection with Myc-tagged PDK1 overexpressing plasmid (OriGene, Rockville, MD).
-
bioRxiv - Cancer Biology 2022Quote: ... were transiently transfected with pCMV6 CMTM6 (Myc-DDK-tagged) (Origene, Cat# RC201061) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Neuroscience 2021Quote: Myc-flag-tagged full-length Cdh8 was purchased from Origene (plasmid #MR218916). Cdh8 was expressed under the CMV promoter in the pCMV6 vector ...
-
bioRxiv - Cell Biology 2020Quote: ... A Myc-Flag-tagged mouse Activin expression plasmid was purchased from Origene Technologies (MR225191) ...
-
bioRxiv - Genetics 2023Quote: ... The Myc-DDK-tagged-CBX1 expression vector was purchased from Origene (RC205672). CBX1 mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... KCNK3 (Myc-DDK-tagged) (TASK-1) (NM_002246.3) was purchased from OriGene (RC215155) and cloned into IRES2 vector using BglII/XhoI sites ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Microbiology 2020Quote: ... The pCMV6 construct coding for myc-FLAG tagged GNG5 was purchased from OriGene.
-
bioRxiv - Microbiology 2021Quote: ... the myc-DDK-tagged-RORC2 cDNA was PCR-amplified from plasmid RC212239 (Origene) and cloned into the MLV-based retroviral vector pMIG Blasti (gift of Jeremy Luban ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Microbiology 2020Quote: Vectors expressing C-terminally FLAG-tagged ATP6V0C and ATP6V0C” were obtained from OriGene Technologies Inc ...
-
bioRxiv - Molecular Biology 2020Quote: ... as well as a (Myc-DDK-tagged)-empty vector were purchased from OriGene.
-
bioRxiv - Biochemistry 2023Quote: ... a Myc- DDK tagged LRPPRC ORF plasmid was obtained from OriGene (CAT: RC216747). This ORF was then subcloned into a hygromycin resistance-containing pCMV6 entry vector (OriGene ...
-
bioRxiv - Molecular Biology 2023Quote: ... as well as a (Myc-DDK-tagged)-empty vector were purchased from OriGene. Anti-zyxin antibody was from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 200 ng purified Myc-tagged lamin A (MW: 74 KDa, OriGene; Cat# TP304970) and 200 ng 6XHis tagged AR (1-556 aa ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant full-length WNK1 (residues 1-2382; OriGene, RC214240) was expressed with a C-terminal Myc-DDK tag from a pCMV6-Entry backbone in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were purchased commercially: NOTCH1 (Origene, Cat# TP762041), CDH6 (ACROBiosystem ...
-
bioRxiv - Cancer Biology 2023Quote: ... biosensors were exposed to recombinant Arc protein (TP304129, OriGene) solution in the assay buffer at a concentration of 30 µg mL-1 of for 130 s ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Microbiology 2020Quote: ... FLAG-tagged MtTop1 was detected with anti-DDK (FLAG) antibodies (Origene, TA50011, 1:2,500). Membranes were incubated with primary antibodies at room temperature for 3 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...