Labshake search
Citations for Origene Technologies :
401 - 436 of 436 citations for Recombinant Human Carboxylesterase 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... transient or tetracyclin-inducible expression of human HEATR5B with an N-terminal GFP tag in human cells) were cloned by Gibson assembly with the full-length human HEATR5B open reading frame (derived from plasmid RC22610 (Origene)) and either pcDNA3.1-eGFP-linker or pcDNA5-FRT/TO-eGFP-linker plasmids (coding for eGFP and a GGSGGSGG linker ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Cell Biology 2022Quote: ... 3×106 HEK293T cells were transfected with pLKO_1 (encoding sh_RNAi) or pCMV6-AC (Origene #RG217766, encoding GFP-UHRF1) lentiviral plasmids ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: The BAP1 RNA knockdown was performed with a set of 3 unique 27-mer siRNA duplexes targeting BAP1 (Origene, SR305435) using siTrans 1.0 (Origene) ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... it was determined that the greatest knockout efficiency had been achieved using the pCas-Guide CRISPR vector with guide RNA sequence of 5’-TAGGTCGCCAAAATCCACAC-3’ (OriGene, KN519669G1). These cells were chosen to produce individual clones using standard single cell cloning techniques in 96-well plates.
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Biochemistry 2021Quote: ... the gene encoding for green fluorescent protein (GFP) and the 3’UTR of the Cpt1a gene were cloned into a unique EcoRI site of pBS31 vector (OriGene Technologies, Rockville, Maryland). This vector contains the phosphoglycerate kinase (PGK ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well received 100 ng of the pMIR-REPORT™ Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, Maryland, USA) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...