Labshake search
Citations for Origene Technologies :
151 - 200 of 437 citations for Recombinant Human CD19 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Cell Biology 2023Quote: ... The AKT2 complex was incubated with recombinant TFEB (TP760282, Origene) for 15 minutes at 37°C in the presence of 10 nm ATP (A1852-1VL ...
-
bioRxiv - Molecular Biology 2024Quote: ... OGDH F: GGTGTCGTCAATCAGCCTGAGT R: ATCCAGCCAGTGCTTGATGTGC (Origene, UK); PGC1α F ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the c17orf80 sequence (NM_001100621) amplified from a commercially available tagged ORF clone (OriGene; RC221916L3) and pDEST-pcDNA5-BirA-FLAG vectors (Couzens et al. ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... A plasmid coding for expression of Flag-HA-mNeonGreen-tagged MmULK4 (cDNA: Origene, MR217918; mNeonGreen (mNG) was provided by Allele Biotechnology and Pharmaceuticals (Shaner et al ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Biochemistry 2023Quote: ... we obtained the WT mS29 gene as a Myc/DDK-tagged ORF from Origene (Cat# RC223182). Using restriction sites AsiSI and PmeI ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 0.25 µg recombinant SLP-76 (OriGene, Cat. TP721201) were then added to the sample and incubated at 30 °C for 60 min ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Control HCT116 cells (WT) were established by transfecting pCMV6-AC-GFP Tagged Cloning Vector (Origene, Cat # PS100010) into HCT116 cells ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: Myc-DDK tagged Mnr (4933427D14Rik) cDNA in cloned in a pCMV6 plasmid was obtained from Origene (MR211309). hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Cell Biology 2023Quote: A Myc-DDK (FLAG)-tagged coding DNA sequence (CDS) clone of murine Runx2 was purchased from Origene within the pCMV-ENTRY overexpression vector (catalogue number MR227321) ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: HCT116 TP53(-/-) cells were transfected with a FLAG-tagged RIG-I expression vector purchased from Origene (RC217615) using Lipofectamine 3000 in six 150 mm dishes plated to 90% confluency the day before ...
-
bioRxiv - Biochemistry 2023Quote: Myc-DDK-tagged lenti ORF clone of c1orf112 (Lenti-Myc-FLAG-RADIF) was obtained from Origene (RC211444L1). Human FIGNL1 sequence-verified cDNA (FIGNL1-cDNA ...
-
bioRxiv - Immunology 2023Quote: The plasmid expressing myc-DDK-tagged wild-type ADA2 (transcript variant 3, NM_001282225) was purchased from OriGene Technologies (#RC238645) ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Cell Biology 2021Quote: ... and the recombinant Sin1 (also known as MAPKAP1, #TP311745) was purchased from Origene. For the knockdown experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... A myc-DDK-tagged aromatase construct (pCMV6-myc-DDK-aromatase) was purchased from Origene (Rockville; Cat. No. MR224509); the pCAG-eGFP has previously been described (Srivastava et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA). PITX1 ΔHD1 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... SLC22A24 (NM_173586 and NM_001136506) tagged open reading frame (ORF) clone and vector control (pCMV6-Entry) were purchased from OriGene. These vectors were either transiently transfected or stably transfected into Flp-In™ 293 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Cancer Biology 2023Quote: ... V5-TKS4 or/and MYC-CD2AP (Myc-DDK-Tagged CD2AP clone) (CAT#: RC210191, Origene Technologies Inc., Rockville, MD) plasmids were transfected using X-tremeGENE Hp DNA Transfection Reagent (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-LGR5 mouse monoclonal conjugated with PE at 1:100 (Origene #TA400001). Apart from the LGR5 antibody incubation (of 20 minutes) ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human