Labshake search
Citations for Origene Technologies :
101 - 150 of 169 citations for Rat ZAP Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes of blots were successively incubated with anti-Hfq polyclonal antibody from Goat (Origene, Germany), with anti-goat secondary antibody coupled to alkaline phosphatase (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Immunology 2019Quote: ... Lysates were incubated with anti-turboGFP antibody (OTI2H8, Origene] or IgG isotype (NCG2B.01, Invitrogen) and Dynabeads Protein G (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... the following antibodies were purchased: goat anti-tdTomato (RRID:AB_2722750, Origene, Rockville, MD, USA, #AB8181-200), rabbit anti-St8sia1 (RRID:AB_1857534 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
bioRxiv - Genomics 2021Quote: ... the corresponding horseradish peroxidase (HRP)-conjugated Goat anti-Rabbit IgG secondary antibody (Origene, Cat#PV-6002) was sequentially used for incubation at room temperature for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary and secondary antibodies were used at the following concentrations: anti-dendra2 1:5000 (OriGene: TA150090), anti-Slack 1:5000 (Aves labs ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cell permeabilization was done in Digitonin Buffer (0.05 % Digitonin and 0.1% BSA in Wash Buffer) followed by incubation with 4µl of the antibody against DUXBL (TA331435, Origene), 1µl of the antibody against FLAG (F1804 ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Molecular Biology 2024Quote: ... Immunoblotting experiments were performed as already described(Notarangelo et al., 2019a) using the following antibodies: tGFP (TA150041, OriGene), SYNTENIN (ab133267 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted fraction was then subjected to immunoblotting assay and MARCH6 was detected using Mouse monoclonal turboGFP antibody (Origene).
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with a mixture of primary rabbit anti–GFP antibody (1:500; catalog #SP3005P, OriGene, Rockville, MD) and mouse anti–NeuN antibody (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Immunology 2019Quote: ... 1 mg of whole-cell extracts (200 μl) were incubated overnight with 1 μg of an anti-flag mouse monoclonal antibody (Origene) at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... Intracellular staining of influenza A nucleoprotein was done by applying the anti influenza A (nucleoprotein) – FITC antibody (OriGene, AM00924FC-N) for 60 min at 4 °C in the dark ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Genomics 2023Quote: Two biological replicates of HMLE cells were UV crosslinked and iCLIP was performed as previously described using anti-hnRNPM antibody (Origene).
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Cancer Biology 2020Quote: The following antibodies were used for immunoblotting following the manufacturer’s recommendations: anti-RIOK2 (1:1000, Sigma HPA005681; 1:1000, Origene Clone OTI3E11), anti-IMP3 (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 20 ng/ml) for 24 h in the presence or absence of 10 μg/ml polyclonal anti-NRG1 antibody (Origene, Rockville, MD), 50 μmol/L ErbB4 inhibitor AG1478 (Origene ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...