Labshake search
Citations for Origene Technologies :
1 - 50 of 51 citations for Rat Serine Racemase SRR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2021Quote: siRNA mediated knockdown of Nt5c2 in rat primary cortical neurons was conducted using the Trilencer 27-mer NT5C2 siRNA kit (Origene: SR307908) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing rat-specific shTET1 was purchased from Origene (#309902). For targeted DNA de-methylation ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ulk1 Rat siRNA Oligo Duplex (SR514693, Origene, San Francisco, CA, USA) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... BDNF (NM_012513) Rat Untagged plasmid was purchased from Origene (OriGene Technologies GmbH, Germany). All other chemicals used in this study were of analytical reagent grade.
-
bioRxiv - Cell Biology 2022Quote: ... The GATA3 construct for overexpression in rat epidermal keratinocytes was obtained from OriGene. All transfections were performed using lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The cDNA of the rat Slc22a9/Slc22a24 (NM_173302.1) was purchased from OriGene (Catalog number: RR202601). The synthesized SLC22A24 ortholog cDNA clones were used to make GFP fusion constructs to determine their subcellular localization ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
Development of immortalized rhesus macaque kidney cells supporting infection with a panel of virusesbioRxiv - Microbiology 2022Quote: ... After removing the supernatant cells were stained with a rat anti-podoplanin antibody (1:100; Origene AM01133PU-N, Rockville, MD, USA) or no antibody in a volume of 50 μl for 30 min on ice ...
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Cell Biology 2022Quote: ... using Lenti-vpak Lentiviral Packaging Kit (Origene Technologies, Inc.). The HEK 293T cells were expanded in DMEM (high glucose ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR/Cas9 knockout (KO) kit was purchased from Origene (KN206895) and cell lines were generated following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Transfections were performed using the Viromer Blue siRNA/miRNA transfection kit following the manufacturers’ instructions (Origene, Rockville, USA). Forty eight hours post siRNA treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and packaging plasmids Lenti-vpak packaging kit with transfection reagent (TR30037) were purchased from OriGene (Rockville, MD, USA) and the experiments were conducted following the instruction of the kit.
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Hepatocytes were transfected with 2.75 µM dsiRNA (Integrated DNA Technologies, Coralville, IA) in nuclease-free duplex buffer using the Viromer® Blue transfection kit (Origene) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...