Labshake search
Citations for Origene Technologies :
1 - 50 of 179 citations for Rat Myristoylated Alanine Rich C Kinase Substrate MARCKS ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Plasmid encoding myc-tagged mouse MARCKS was purchased from Origene. Plasmid encoding HA-PKCα was a gift from Bernard Weinstein (Addgene plasmid #21232) ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and creatine kinase U-type (CKMT1) cDNA (Origene, Rockville, MD) were cloned into pET-30a vectors (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2023Quote: ... This residue is alanine in the NCBI RefSeq sequence but is a threonine in commercial clones available from Origene (catalog # RG220167), as well as a conserved threonine across most other mammalian species (Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208) for 18hrs at 37° ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2021Quote: siRNA mediated knockdown of Nt5c2 in rat primary cortical neurons was conducted using the Trilencer 27-mer NT5C2 siRNA kit (Origene: SR307908) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing rat-specific shTET1 was purchased from Origene (#309902). For targeted DNA de-methylation ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... a CMV promoter driven rat RTN3 plasmid was purchased from Origene, Rockville ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ulk1 Rat siRNA Oligo Duplex (SR514693, Origene, San Francisco, CA, USA) was used ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-mGFP (Origene). The reaction mix was filled up to 104 μl with OptiMEM (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Scrambled vector sh-Control (sh-C) was purchased from OriGene (pGFP-C-sh-Lenti, TR30021). Lentiviral packaging constructs PAX2 (12260 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... BDNF (NM_012513) Rat Untagged plasmid was purchased from Origene (OriGene Technologies GmbH, Germany). All other chemicals used in this study were of analytical reagent grade.
-
bioRxiv - Cell Biology 2022Quote: ... The GATA3 construct for overexpression in rat epidermal keratinocytes was obtained from OriGene. All transfections were performed using lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Molecular Biology 2019Quote: ... and C (SR305183, OriGene, Rockville, MD) or non-silencing siRNA (SR30004 ...
-
bioRxiv - Neuroscience 2022Quote: ... pLenti-TDP-43WT-C-mGFP (Origene), and pLenti-TDP-434FL-C-mGFP ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Cancer Biology 2019Quote: ... or RELA siRNA (Origene, SR 321602A-C). Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene ...
-
bioRxiv - Cell Biology 2023Quote: ... was pGFP-C-shLenti also from Origene.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The cDNA of the rat Slc22a9/Slc22a24 (NM_173302.1) was purchased from OriGene (Catalog number: RR202601). The synthesized SLC22A24 ortholog cDNA clones were used to make GFP fusion constructs to determine their subcellular localization ...
-
bioRxiv - Molecular Biology 2021Quote: ... two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C, SCR siRNA Origene SR30004 and POLYPLUS INTERFERIN #409-10 as Transfection reagent).
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Molecular Biology 2021Quote: Alkbh1 Rat Tagged ORF Clone Lentiviral Particles and Mock control were purchased from Origene (Cat# RR214755L2V). Cells were transfected with lentiviral particles in the presence of polybrene (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-Myc-DDK-P2A-Puro (Origene), pLenti-TRIM9-C-mGFP (Origene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-mGFP-P2A-puro-FGF19 (Origene, RC203750L4), EdTP (dominant negative Tcf4 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Neuroscience 2021Quote: ... with the full-length c DNA for CCL2 (OriGene). AAV serotype 5 (AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...