Labshake search
Citations for Origene Technologies :
151 - 200 of 312 citations for Rat Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the membrane was incubated overnight at 4°C with primary antibody solution (1:1000 dilution for anti-TSG101 [Abcam, ab30871], anti-Calnexin [ThermoFisher, PA5-19169] and anti-Syntenin-1 [Origene, TA504796] ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Ly6G/GR1 Granulocyte Marker (Origene #DM3589P, 1:100), and CD3 (BioRad #MCA1477 ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:1000 Anti-DDK (FLAG) Clone 4C5 (OriGene Cat# TA50011-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFP rabbit polyclonal (Origene, TA150032, 1:10,000), anti-HA mouse monoclonal (BioLegend ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUBB3 (Origene, TA500047, 1:3,000 dilution), anti-GAPDH conjugated peroxidase (Proteintech ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-NOB1 (1:1000, Origene TA808793 clone OTI1C12), anti-phospho-Ser/Thr-Pro MPM-2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of expression clone cDNA (Origene NM_001923) or control cDNA (Origene PS100093 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Goat anti-Tdtomato (Origene AB8181; 1:500).
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-DDK-Flag tag (Origene, 1:2000); rabbit anti-pS/TQ (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Cancer Biology 2020Quote: The following antibodies were used for immunoblotting following the manufacturer’s recommendations: anti-RIOK2 (1:1000, Sigma HPA005681; 1:1000, Origene Clone OTI3E11), anti-IMP3 (1:1000 ...
-
bioRxiv - Biophysics 2019Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
-
bioRxiv - Cell Biology 2020Quote: Recombinant full-length WNK1 (residues 1-2382; OriGene, RC214240) was expressed with a C-terminal Myc-DDK tag from a pCMV6-Entry backbone in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... (ii) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD71-APC (1:200 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... DDK (FLAG) (#TA50011, 1:2000 for western blot; Origene); V5 (#46-0705 ...
-
bioRxiv - Cell Biology 2021Quote: ... (ii) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD71-APC (1:200 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... and β-actin (mouse; 1:5000; ORIGENE; #TA-09), followed by HRP conjugated secondary antibodies against rabbit or mouse IgG (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-GABRA5 (1:200, Origene Cat# TA338505), guinea pig polyclonal anti-GAD2 (1:200 ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Immunology 2020Quote: ... washing with PBST three times, mouse anti-HA-tag lgG2a mAb (4A.Biotech, 4ab000002, Beijing, China 1:1000) or lgG1 mAb (Origene, TA180128, USA, 1:2000) were added into each well (40 μl/well) ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were boiled in 1× citrate buffer (ORIGENE, ZLI-9064) and then microwaved at low power for 15 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... or Guinea Pig anti-CK20 (Origene Tech, Germany, 1:200). Secondary antibodies used were anti-rabbit Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2022Quote: ... (1) the commercial template plasmid pCMV6-Entry-UBE3C (Origene #:RC215110) was amplified using primers which partially inserted the intergenic fusion sequence and simultaneously deleted the UBE3C coding sequence downstream of p.Val443 (F ...
-
bioRxiv - Cancer Biology 2019Quote: ... and polyclonal anti-rabbit IgG (1:5000, R1364HRP, OriGene, Germany). Proteins were detected using chemiluminescence HRP substrate (Merck) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1 μg of anti-flag (α-DDK, TA50011, Origene) in 1 ml of lysis buffer containing 1 mg of total protein extract ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Pathology 2024Quote: ... The coding sequence for Gremlin-1 (Origene, Cat-No RC210835) was inserted into the plasmid pWPI (kindly provided by Roy Bicknell at University of Birmingham) ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...