Labshake search
Citations for Origene Technologies :
101 - 150 of 351 citations for Rat CPS1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ulk1 Rat siRNA Oligo Duplex (SR514693, Origene, San Francisco, CA, USA) was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... PTEN-depleted 22RV1 cells were generated following lentiviral transfection of HuSh-29 pre-designed PTEN shRNA pGFP-V-RS constructs (Origene, Rockville, MD, USA), and selected under puromycin selection pressure at a final concentration of 0.5 μg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... The cell lines MDA-231-TL313602 stably expressing shCYP27A1 (29 mer shRNA constructs against hCYP27A1 in lentiviral GFP (cat# TL313602, Origene, Rockville, MD, USA): A ...
-
bioRxiv - Cancer Biology 2020Quote: ... PNT1A-HIP1 cells transfected with plasmid expressing scrambled hairpin RNA (Origene, HuSH pRS plasmids #TR312457) supplied within the same kit ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...
-
bioRxiv - Immunology 2023Quote: Bone marrow cells from the femurs of LB2 mice were isolated and transduced with either scrambled or Annexin A1 (Anxa1) shRNA using TR30030 pRFP-C-shLenti vector (Origene Technologies Inc. MD, USA) at an MOI of 150 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each guide RNA was cloned into a plasmid containing Cas9-GFP (OriGene plasmid GE100018, Rockville, MD). Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... A CREBBP plasmid (NM_004380) and the corresponding EV Control plasmid was ordered from Origene (Rockland, MD). EP300 siRNA (siEP300_1 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with lentiviral plasmids and the appropriate packaging plasmids using turbofectamine (Origene, TR30037) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: The Gpr183 expression plasmid (Origene MR205447) was used as the wildtype control and underwent site-directed mutagenesis ...
-
bioRxiv - Neuroscience 2020Quote: ... GFP plasmids were obtained from Origene and Lonza ...
-
bioRxiv - Cancer Biology 2022Quote: ... and GCLC overexpressing plasmid (Origene, MC203908) were used ...
-
bioRxiv - Pathology 2021Quote: ... HMGB1 plasmid was purchased from Origene. 24h after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids containing OGA (Origene cat # RC222411) or OGT (Origene cat # RC224481 ...
-
bioRxiv - Neuroscience 2023Quote: ... ZBTB7A overexpression plasmids (Origene Cat. #RC222759) were cloned into either a Lentiviral CMV-driven construct for use in cell culture experiments (shown in Figure S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a plasmid containing SNX27-FLAG under CMV promoter (pCMV-SNX27-FLAG, OriGene Technologies plasmid #MR218832). For SNX27 knockdown experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... The GATA3 construct for overexpression in rat epidermal keratinocytes was obtained from OriGene. All transfections were performed using lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Alkbh1 Rat Tagged ORF Clone Lentiviral Particles were purchased from Origene (Cat# RR214755L2V). Lipofectamine RNAimax was purchased from Thermo Fischer (Cat# 13778150) ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids GCK (MSP4K2) (cat. no. RC200472, OriGene), HGK (MAP4K4 ...
-
bioRxiv - Neuroscience 2020Quote: ... and Nup98 plasmids were obtained from Origene. Additional POM121 and sPOM121 plasmids (Franks et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids harboring C-terminally Flag-tagged wild-type or mutant human TDP-43 and p38α sequences in the pcDNA3.1+/C-(K)-DYK mammalian expression vector were purchased from Genscript and PRMT1 plasmid was purchased from Origene. TDP-43 bacterial expression vector harboring a C-terminal MBP tag (pJ4M TDP-43-TEV-MBP-6xHis ...
-
bioRxiv - Neuroscience 2021Quote: ... lentiviral expression plasmid pSKAP2-mGFP (Origene #MR205468L2) was used.
-
bioRxiv - Cancer Biology 2024Quote: Viral vector plasmids were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The human FLAG-tagged EMC5 plasmid (catalog #: RC207046) and FLAG-tagged EMC6 plasmid (catalog #: RC215548) were obtained from Origene. The mutations EMC3-R31A ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 300 ng of each sgRNA plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin (OriGene). For competitor experiments ...
-
bioRxiv - Genomics 2021Quote: ... Cells were transfected with 400 ng of sgRNA-15xPBS plasmid and 40 ng of Clover-PUFc fusion plasmid DNA using 3.5 μl Turbofectin (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Biophysics 2024Quote: ... HEK293T cells were transfected with rat CaMKIIα WT (pCMV6-CaMKIIα-Myc-DDK, #RR201121, Origene), which was generated and sequence-verified by GenScript Biotech (Leiden ...
-
bioRxiv - Cell Biology 2022Quote: ... HESCs were transfected with an empty expression plasmid (control) or human KISS1R expression plasmid corresponding to the open reading frame (Origene) or human ESR1 expression plasmids hESR1-46 or hESR1-66 (Flouriot ...
-
bioRxiv - Physiology 2022Quote: HeLa and SH-SY5Y CSB CRISPR-Cas9 knockouts were generated with the following plasmid: the plasmid used was modified from a pCas-Guide-EF1a-Cherry from Origene, modified to contain a guide RNA targeting the PARP binding domain of CSB ...
-
bioRxiv - Immunology 2020Quote: The pCMV6-Entry-COPA-myc-DDK plasmid (Origene) was used as a template to generate COPA mutant E241K and R233H expressing plasmids via QuikChange Lightning Multi Site-Directed Mutagenesis (AgilentTechnologies ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... LMTK3 plasmid was purchased from Origene (Rockville, MD). PKC inhibitor ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA fragments were cloned into pLenti plasmid (Origene) (EcoRI and PspXI) ...
-
bioRxiv - Neuroscience 2022Quote: C21orf2 plasmid was purchased from Origene (Cat#: RG210047). Mutagenesis was performed using Quickchange II kit from Aligent with primers found in extended data table 5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The FMOD overexpression plasmid was bought from Origene, USA (#LY419579) ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were purchased from Addgene and MYC/FLAG-hIMPDH2 (#RC202977) plasmid from Origene. EZH2 (1-170) ...
-
bioRxiv - Cell Biology 2023Quote: ... the plasmid K07 (OriGene Technologies, Inc., Rockville, USA), which lacked homology with any known mRNA ...
-
bioRxiv - Biochemistry 2023Quote: Lentiviral plasmid shDCP1b (Origene, Rockville, MD, CAT#: TL305088)
-
bioRxiv - Biochemistry 2023Quote: Lentiviral plasmid shDCP1a (Origene, Rockville, MD, CAT#: TL305089)
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The cDNA of the rat Slc22a9/Slc22a24 (NM_173302.1) was purchased from OriGene (Catalog number: RR202601). The synthesized SLC22A24 ortholog cDNA clones were used to make GFP fusion constructs to determine their subcellular localization ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Bioengineering 2020Quote: ... and pCas9-scrambledRNA-zsG-MC (Cas9-scrambled-MC) parental plasmids originated from pCas-Guide-AAVS1 and pCas-Guide-Scrambled plasmids purchased from Origene (Maryland, USA). The Cas9 enzyme and guide RNA sequences were cloned between attB and attP recombination sites in a minicircle bacterial backbone containing a ZsGreen (zsG ...
-
bioRxiv - Molecular Biology 2020Quote: ... we overexpressed a pCMV6-Pdcd7-Myc plasmid (OriGene, #MR214517) in HEK293T cells using GenJet II (SignaGen ...