Labshake search
Citations for Origene Technologies :
51 - 100 of 432 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Neuroscience 2021Quote: ... PVDF membranes were incubated with the indicated primary antibodies (anti-HA: Cell Signaling Technology, C29F4, Rabbit mAb CAT#: 3724, 1:1000; anti-FLAG: Origene, mouse monoclonal antibody ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells (3×106 cells) were seeded in a 10 cm dish and transfected with 6 μg of FLAG-tagged human CREBBP plasmids (Origene,USA) using Metafectene (Biontex ...
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... Primary anti-DDK immunoglobulin [TA50011-100] was obtained from OriGene Technologies Inc ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Biophysics 2019Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Neuroscience 2020Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLAG-tagged human angiogenin plasmid (Cat# RC208874; OriGene; Rockville, MD), GFP-tagged rat RNH1 plasmid (Cat# ORa42809C ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
-
bioRxiv - Genomics 2019Quote: Human myc-FLAG tagged PPP2R3B ORF clone from Origene (RC222908) was linearised and the insert DNA amplified using modified primers generating an N-terminal Myc tag ...
-
bioRxiv - Microbiology 2021Quote: ... A soluble fragment of human LAMP1 was obtained from Origene Protein (Cat# TP720784) ...
-
bioRxiv - Cell Biology 2021Quote: ... and human normal brain tissue qPCR array (OriGene Technologies, HBRT101) were used ...