Labshake search
Citations for Origene Technologies :
1 - 50 of 324 citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A; Origene), and MUC5B (Invitrogen ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNA encoding rat ANP receptor (GenBank ID: NM_012613) was purchased from OriGene Technologies Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were stably transfected with either empty vector (pCMV6) or Sox9 expression vector (Origene). These cells were then utilized for promoter luciferase reporter assays using methods reported in our recent studies (31,61) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293 cells were stably transfected with HA-MOP and GFP-conjugated GIRK2 channel plasmids (OriGene). The cells were then seeded in 96-well plates and allowed to grow at 37°C in 5% CO2 for 48 h ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Immunology 2020Quote: ... cDNA clones in pCMV6 plasmid for these chemokine receptors were obtained from Origene (Rockville, MD). 2 million L1.2 cells were transfected with 2 µg of plasmid using the SG Cell Line transfection kit and a 4D-Nucleofector X (both from Lonza ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...