Labshake search
Citations for Origene Technologies :
1 - 50 of 475 citations for Mouse ZNF583 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: We used an Adamts12 Mouse shRNA Plasmid (OriGene, Locus ID: 239337) and transfected LLC/2-luc-M38 (Caliper ...
-
bioRxiv - Neuroscience 2024Quote: The pGFP-A-shAAV shRNA cloning plasmids against mouse Gprc6a (Origene, HC141118) were designed for transfection in mouse N2a cells and production for rAAVs ...
-
bioRxiv - Cell Biology 2024Quote: ... The scrambled shRNA and IP3R1 shRNA plasmids were purchased from OriGene; the 29mer sequence of scrambled shRNA (Cat# TR30015 ...
-
bioRxiv - Neuroscience 2020Quote: ... shRNA plasmids were obtained from OriGene against the following mRNA target sequences ...
-
bioRxiv - Neuroscience 2021Quote: ... an shRNA plasmid was obtained from OriGene against the following mRNA target sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells transfected with plasmids expressing Ube2e1 shRNA (Origene) were selected for using 0.5μg/ml puromycin for 5 passages ...
-
bioRxiv - Neuroscience 2024Quote: ... The pGFP-A-shAAV shRNA plasmid (Origene, #TR30034) served as the scramble control to produce turbo GFP (tGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Cell Biology 2020Quote: ... Bmf-specific shRNA plasmids and control plasmids were purchased from OriGene (OriGene Technologies, Inc.) and were packaged into retroviral particles using Phoenix cells as specified by the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2023Quote: ... The spectrin-silencing shRNA plasmids were constructed in the pRFP-C-RS backbone (Origene). These plasmids allow cloning and expression of shRNA under a U6 promoter and co-expression of the TurboRFP red fluorescent protein under the control of a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi, 0415). The cells were transfected using Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Neuroscience 2022Quote: ... Smoothened shRNA in pGFP-V-RS shRNA Vector (TG510788, Origene).
-
bioRxiv - Neuroscience 2022Quote: ... Scrambled shRNA control in pGFP-V-RS shRNA Vector (TR30013, Origene); Smoothened shRNA in pGFP-V-RS shRNA Vector (TG510788 ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2020Quote: ... scrambled shRNA (Origene, TR30012) and pool of sh-Spag5 (Origene ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the transgenic LGALS1 KD BTSCs were generated via lentivirus carrying two different LGALS1 shRNA plasmids (OriGene, #TL311756). LGALS1 KD BTSC73 lines were established by antibiotic selection (0.5 μg/mL puromycin) ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmid constructs containing short hairpin RNA (shRNA) cassettes in the pRFP-C-RS vector were purchased from OriGene Technologies ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... using scrambled shRNA (Origene, TR30012) or pool of sh-Diaph3 (Origene ...
-
bioRxiv - Cell Biology 2023Quote: ... Stable TFEB knockdown was achieved by transfecting TFEB-specific shRNA cloned in pRFP-C-RS plasmid (OriGene RNAi, 0513). The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi ...
-
bioRxiv - Biochemistry 2023Quote: ... mature 3T3-L1 adipocytes were transfected with FXN shRNA scramble shRNA (Origene, Rockville, MD, USA), using LipofectamineTM 2000 transfection reagent (ThermoFisher ...
-
bioRxiv - Cancer Biology 2023Quote: In case of TRF2 shRNA (Origene)/TERC shRNA (Santa Cruz Biotechnology) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V, OriGene, Rockville, MD, USA).
-
bioRxiv - Physiology 2023Quote: ... BV2 cells were infected with 25 MOI of FXN shRNA or scramble shRNA (Origene, Rockville, MD, USA) for a total of 500000 viral particles/well ...
-
bioRxiv - Physiology 2021Quote: ... GGC CCG ATT GCT TCG AGA A (Nrf1) and pRFP-C-RS scrambled shRNA plasmid vectors were obtained from OriGene (TR30015). For analgesia ...
-
bioRxiv - Immunology 2021Quote: ... scramble and CAI shRNA lentiviral supernatant were produced by transfection of 293T cells with packaging lentiviral plasmids and either scramble or CAI shRNA lentiviral vectors (Origene, TL510087) followed by concentrating with Lenti-X concentrator (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... SLC7A11-shRNA sequence 1 (Origene, Cat. TL309282). Transduced cells were maintained in puromycin and GFP positive cells sorted on a BD FACS Melody cell sorter ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (Origene, cat.#TR30021) and using the adequate drug for cell selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... or shRNA negative control (OriGene, cat.#TR30033), and using the appropriate drug for cell selection.
-
bioRxiv - Cancer Biology 2023Quote: ... TRF2 shRNA was procured from Origene (TL308880). Side-directed Mutagenesis was performed on the TRF2 WT plasmid to generate the PTM mutants.
-
bioRxiv - Neuroscience 2019Quote: Four shRNAs against Mus musculus Cyp19a1 and one control scrambled shRNA were obtained from Origene (Rockville; Cat No. TG509276). These plasmids express both shRNA under the control of the U6 promoter and turboGFP under the control of a CMV promoter ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse OSM expression plasmid (MR226014) was purchased from Origene. Mouse STAT3-Y705F plasmid was kindly provided by Prof ...
-
bioRxiv - Biochemistry 2023Quote: Mouse RBM3 gene from RBM3-PUC plasmid (Origene MC203679) was cloned into pMIG-GFP plasmid by restriction digestion method using Bgl2 and EcoR1 (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse EDA-A2 (MC208415) and mouse OSM (MR226014) expression plasmids were purchased from Origene. Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14) ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Developmental Biology 2019Quote: ... Short RNA hairpin (sh-RNA)-based expression vectors for RNA interference pRFP-C-RS (FZD10 shRNAs and scrambled shRNA) were purchased from Origene. The three sequences were ...
-
bioRxiv - Molecular Biology 2023Quote: ... Short hairpin RNA (shRNA) knockdown (KD) cell lines were generated through lentiviral delivery of shRNA pools targeting CBX2 (Origene TL314173), CBX4 (Origene TL314171) ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Cell Biology 2021Quote: Short hairpin RNAs (shRNAs) targeting Acsl4 (TL502838, OriGene) were packaged in the pGFP-C-shLenti plasmid system ...
-
bioRxiv - Cell Biology 2022Quote: ... Axl and scramble shRNAs were purchased from Origene. Recombinant hGas6 and Axl inhibitor R428 were purchased from R&D system ...