Labshake search
Citations for Origene Technologies :
251 - 289 of 289 citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Immunology 2019Quote: Plasmids of the wild-type mouse Mul1 (pMul1-FLAG) and Asc (pAsc-Myc) were constructed using pCMV6 Mul1-Myc/DDK (MR205346, Origene, Rockville, MD, USA) and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a mouse monoclonal antibody OTI5F12 (likely an internal epitope since the full 479 aa sequence was used as an antigen; Origene Technologies, Rockville, MD) were used as capture antibodies for the enrichment of ERG protein from cell lysates (Figure 1B) ...
-
bioRxiv - Neuroscience 2021Quote: Membranes were blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA) and were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti-β-tubulin (1:5000 ...
-
bioRxiv - Immunology 2020Quote: ... washing with PBST three times, mouse anti-HA-tag lgG2a mAb (4A.Biotech, 4ab000002, Beijing, China 1:1000) or lgG1 mAb (Origene, TA180128, USA, 1:2000) were added into each well (40 μl/well) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Cell Biology 2021Quote: The SacsJ cDNA (corresponding to residues 4316-4420) inserted in frame with GST into the pGEX6 vector was amplified from the mouse pEGFP-sacsin full length (OriGene Technologies, Rockville, MD, USA). For delivery into cells and tissues ...
-
bioRxiv - Cell Biology 2024Quote: The DNAJ cDNA (corresponding to residues 4316-4420 of sacsin) was subcloned using mouse pEGFP-sacsin full length cDNA (OriGene Technologies, Rockville, MD, USA) and inserted in frame with GST into the pGEX6 vector ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Transfections were performed using the Viromer Blue siRNA/miRNA transfection kit following the manufacturers’ instructions (Origene, Rockville, USA). Forty eight hours post siRNA treatment ...
-
bioRxiv - Cancer Biology 2023Quote: ... and packaging plasmids Lenti-vpak packaging kit with transfection reagent (TR30037) were purchased from OriGene (Rockville, MD, USA) and the experiments were conducted following the instruction of the kit.
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: Replication incompetent lentivirus were produced in HEK 293T cells co-transfected by mixing 5 µg of either pLKO.1 Empty Vector or pLKO.1 shRNA targeting SMARCD3 with 6 µg Lenti-vpak packaging kit components (OriGene) and 33 µL of transfection reagent (OriGene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentiviral particles were generated by co transfection in Lenti-X™ 293T cells (Takarabio) of lentiviral packaging kit (Origene) and plasmids for the expression of IL2-GFP+ ...
-
bioRxiv - Cell Biology 2019Quote: ... Hepatocytes were transfected with 2.75 µM dsiRNA (Integrated DNA Technologies, Coralville, IA) in nuclease-free duplex buffer using the Viromer® Blue transfection kit (Origene) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Neuroscience 2021Quote: siRNA mediated knockdown of Nt5c2 in rat primary cortical neurons was conducted using the Trilencer 27-mer NT5C2 siRNA kit (Origene: SR307908) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...