Labshake search
Citations for Origene Technologies :
301 - 350 of 475 citations for Mouse TXNDC8 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product and the plasmid pLenti-C-mGFP (# PS100071 OriGene Technologies, Rockville, MD, USA) were digested with Asc1 (#R0558L Bioconcept ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Csde1 ORF clone (Origene, MR210719, NM_144901, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag using AgeI/EcoRI restriction sites.
-
bioRxiv - Cell Biology 2021Quote: ... Mouse mAb anti-6xHis tag (clone HIS.H8) was from OriGene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse Gpr151 ORF clone (Origene, MR223707, NM_181543, Myc-DDK-tagged) was sub-cloned into FUGW vector including its original Myc-DDK-tag with no any UTRs at AgeI/EcoRI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: Full length mouse Lox (mLox) cDNA was purchased from OriGene. The full length ORF was amplified by PCR using forward and reverse primers respectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Myc-RIP2 and Myc-TRAF6 were obtained from Origene. All high-fidelity PCR was performed using NEB Q5 polymerase and all subcloning was done using NEBuilder HiFi DNA Assembly (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and HA-tagged mouse VHL ORF Clone (Origene; Cat #MR201630) as templates to amplify human and mouse VHL ...
-
bioRxiv - Cell Biology 2024Quote: ... and mouse anti-BTN3A2 antibodies (ORIGENE, USA, #CF500730, 1:50), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA for the coding sequence of mouse CCN1 (Origene # MR221828) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Cell Biology 2022Quote: ... A plasmid coding for expression of Flag-HA-mNeonGreen-tagged MmULK4 (cDNA: Origene, MR217918; mNeonGreen (mNG) was provided by Allele Biotechnology and Pharmaceuticals (Shaner et al ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with 1 μg of pCMV-Entry-Empty or pCMV-Entry-ETV7 plasmid (Origene and(20)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Neuroscience 2022Quote: ... The DNA templates were made by PCR amplification from a plasmid pCMV6-mNlgn2(A+)-mycDDK (Origene, catalog #MR222168 ...
-
bioRxiv - Microbiology 2022Quote: ... as well as a negative control plasmid (pCMV6-Entry) lacking a cDNA insert (OriGene Technologies, Inc.). A list of all plasmids encoding HB gene cDNAs (including product numbers ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral pseudoparticles were obtained after plasmid transfection of 293T cells using TurboFectin 8.0 Transfection Reagent (Origene). The medium was replaced after 6-12 h with fresh media with 1X Viral boost (Alstem) ...
-
bioRxiv - Cell Biology 2023Quote: ... the KPNB1 coding sequence was PCR amplified from the KPNB1 ORF clone plasmid (Origene, cat# RC200659) and XbaI and BamHI restriction sites were added to the ends of the fragment ...
-
bioRxiv - Neuroscience 2023Quote: ... mCherry in pcDNA3.1 was also generated by Genescript and the TGN38 plasmid was purchased from Origene.
-
bioRxiv - Cancer Biology 2020Quote: ... was purchased from Sigma Aldrich and mouse anti-PDLIM2 Ab (1:250) was purchased from Origene. Rabbit anti-FAK Abs (1:500) ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse Scyl1 cDNA was amplified from a construct (MR210762, Origene) and cloned into an existing vector downstream of the T3 promoter ...
-
bioRxiv - Immunology 2022Quote: ... The membrane was probed with anti-ZFP36 mouse monoclonal (Origene #OTI3D10) (2 μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Biochemistry 2022Quote: The mouse Phf8 transcript (NM_177201) was purchased from Origene (Cat#: MR223276) and subcloned into a pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Mouse P2X5 (mP2X5) cDNA in pCMV6-Entry was purchased from OriGene and subcloned into pcDNA3.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... with mouse monoclonal anti-FLAG antibody (anti-DDK; 1:1,000, OriGene) in blocking solution for 2–3 days ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Molecular Biology 2021Quote: ... CRISPR/Cas9 plasmid constructs were assembled using the pLenti-Cas-Guide construction Kit (GE100010, OriGene, Maryland, USA) and each sgRNA was ligated into the pLenti-Cas-sgRNA backbone as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pCMV6-UBE2M-Myc-DDK (DDK is the same as FLAG®) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... Absolute quantification of RNA levels was performed by creating standard curves with plasmids for GRHL1 (Origene, #RC229312), GRHL2 (Origene ...
-
bioRxiv - Pathology 2019Quote: ... N- and C-fragment were cloned into a lentiviral expression plasmid (Cat. No: PS100101, OriGene, Rockville, MD). For generating CRIPSR KO podocytes ...
-
bioRxiv - Bioengineering 2020Quote: ... to transfect GFP-tagged human tumor necrosis factor receptor superfamily 10b (GFP-TNFRSF10B/GFP-DR5) plasmid (OriGene) into the cell lines ...
-
bioRxiv - Genetics 2021Quote: ... Oligos encoding the gRNAs were annealed and cloned into pCas-Guide-EF1a-GFP CRISPR/Cas9 plasmid (OriGene), according to the manufacturer instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Cell Biology 2021Quote: Myc-DDK tagged Mnr (4933427D14Rik) cDNA in cloned in a pCMV6 plasmid was obtained from Origene (MR211309). hTERT-RPE1 cells were transfected using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Cancer Biology 2022Quote: The plasmid DNA pCMV6-AC and the transfection control pCMV-MIR were purchased from OriGene (Maryland, EEUU). Caco-2 cells were plated (10·106 cells ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro, Origene PS100092) using Lipofectamine 3000 and cultured for 48 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...