Labshake search
Citations for Origene Technologies :
151 - 200 of 241 citations for Mouse Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... 200.000 cells were resuspended in the nucleofection solution containing 800 ng plasmid DNA (SC118279, Origene, or eGFP in pcDNA3.1) and analysed after 72 h.
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
Mck1 defines a key S-phase checkpoint effector in response to various degrees of replication threatsbioRxiv - Molecular Biology 2019Quote: ... Hug1-13MYC protein levels were detected with mouse anti-MYC antibody (1:1000, ORIGENE) and HRP-conjugated anti-mouse IgG as the secondary antibody (1:10000 ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral particles containing pLenti-C-PPARG2-mGFP-P2A-Puro or pLenti -mGFP-P2A-Puro were purchased from Origene (Maryland, USA). Titers were provided by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were co-transfected with a (mouse) LHX1 expression construct (Origene Technologies Inc., Rockville, MD, USA) in which Myc-DDK-tagged-LHX1 is expressed from pCMV6 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Cell Biology 2020Quote: ... the samples were immunostained with the anti-IRSp53/BAIAP2 antibody 1D9 (mouse monoclonal, 1:200, OriGene) and anti-HLA A antibody EP1395Y (rabbit monoclonal ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Biochemistry 2020Quote: ... the mGFP cDNA was inserted between the region encoding the 71st and 82nd amino acids of mouse Gαs (Origene) in the pcDNA3.1 (+ ...
-
bioRxiv - Neuroscience 2021Quote: ... SP6 transcribed antisense and T7 transcribed sense control probes were synthesized from mouse Fcgr1 (NM_010186) cDNA clone (MR225268, OriGene) using 1 set of primers (forward ...
-
bioRxiv - Biochemistry 2021Quote: ... The eluted fraction was then subjected to immunoblotting assay and MARCH6 was detected using Mouse monoclonal turboGFP antibody (Origene).
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... using Lenti-vpak Lentiviral Packaging Kit (Origene Technologies, Inc.). The HEK 293T cells were expanded in DMEM (high glucose ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...