Labshake search
Citations for Origene Technologies :
451 - 483 of 483 citations for Mouse IgG2b Isotype Control Antibody Biotin A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Full-length cDNA for Human KCNT1 Transcript 1 NM_020822.1 (Origene Technologies Inc, Rockville, MD, USA) was mutagenised to induce point mutations ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with 1 μg of pCMV-Entry-Empty or pCMV-Entry-ETV7 plasmid (Origene and(20)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Immunology 2023Quote: ... tagged ADA2 was pulled down using 1 µg anti-DDK (FLAG) clone OTI4C5 (#TA50011, OriGene Technologies). An isotype control sample was incubated with 1 µg mouse IgG1 (#02-6100 ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Microbiology 2020Quote: ... human MSR1 (Cat# RC209609) and Beclin 1 (Cat# MR207162) were obtained from Origene (Rockville, MD 20850, USA). pcDNA-FLAG-Ulk1 (Plasmid # 27636 ...
-
bioRxiv - Cell Biology 2022Quote: The full length of human PCDH15-CD1-1 (Q99PJ1, uniport) cloned in pcDNA3.1 was obtained from OriGene. PCDH15-CD2 (Q99PJ1-10 ...
-
bioRxiv - Neuroscience 2022Quote: ... were double immunostained using the following antisera couples: a) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-NUCB2/nesfatin-1 antibody (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Biochemistry 2019Quote: ... the coding region for full-length human GCP2 (amino acids 1-902) was amplified by PCR using its cDNA as template (NM_001256617.1, Origene). The mTagBFP (blue fluorescent protein ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Immunology 2022Quote: Lung section slides were also stained with 1 µg/mL rabbit polyclonal anti-NEU1 (TA335236; Origene, Rockville, MD), anti-NEU2 (TA324482 ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cell Biology 2020Quote: ... passage 1 of pHCEnC were transfected with 10 nM anti-SLC4A11 siRNA (CCGAAAGUACCUGAAGUUAAAGAACT) or scrambled siRNA (OriGene Technologies, Rockville, MD, USA) using Lipofectamine LTX (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... For each construct, 1 µg DNA (wt 2N4R tau, N167Q 2N4R tau, N368Q 2N4R tau or AEP (Origene clone no. RC200309)) was used ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Cancer Biology 2019Quote: For exogenous over-expression of CD82 and KDELR3 genes the following expression plasmids were used: CD82 transcript variant 1 (NM_002231) Human Untagged Clone (Origene, CAT#: SC324395), pCMV6-AC Tagged Cloning mammalian vector with non-tagged expression (Origene ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected either with scramble SiRNA (10 nM) or MAS-1 SiRNA (10 nM) according to manufacturer’s instructions (Origene Technologies, Rockville, MD, USA). Two days after transfection ...