Labshake search
Citations for Origene Technologies :
1 - 50 of 310 citations for Mouse Cytochrome C Oxidase Subunit II COX2 MT CO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated for at least 20 hours at room temperature with a combination of the following primary antibodies in PBS-TX with 2% NGS or NDS: rabbit anti-α5 GABAA receptor subunit (1:200; TA338505, OriGene Tech., Rockville, USA), rabbit anti-α1 GABAA receptor subunit (1:300 ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Hexokinase II (TA325030, 1:500, Origene), Glut1 (ab115730 ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Genomics 2019Quote: ... pGFP-C-shRNA-Lenti-B2M and pGFP-C-scrambled were purchased from Origene. The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-mGFP (Origene). The reaction mix was filled up to 104 μl with OptiMEM (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... (ii) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD71-APC (1:200 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... (ii) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD71-APC (1:200 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Scrambled vector sh-Control (sh-C) was purchased from OriGene (pGFP-C-sh-Lenti, TR30021). Lentiviral packaging constructs PAX2 (12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and C (SR305183, OriGene, Rockville, MD) or non-silencing siRNA (SR30004 ...
-
bioRxiv - Neuroscience 2022Quote: ... pLenti-TDP-43WT-C-mGFP (Origene), and pLenti-TDP-434FL-C-mGFP ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Cancer Biology 2019Quote: ... or RELA siRNA (Origene, SR 321602A-C). Cells were transfected with siRNA using siTran 1.0 transfection reagent (Origene ...
-
bioRxiv - Cell Biology 2023Quote: ... was pGFP-C-shLenti also from Origene.
-
bioRxiv - Cell Biology 2021Quote: Mouse Igfbp3 cDNA (Origene) was amplified with attB-containing primers and cloned into pDONR 221 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse PRRX1 (Origene TA803116), rabbit YAP (Cell Signaling 14074) ...
-
bioRxiv - Molecular Biology 2021Quote: ... two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C, SCR siRNA Origene SR30004 and POLYPLUS INTERFERIN #409-10 as Transfection reagent).
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-Myc-DDK-P2A-Puro (Origene), pLenti-TRIM9-C-mGFP (Origene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-mGFP-P2A-puro-FGF19 (Origene, RC203750L4), EdTP (dominant negative Tcf4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse EDA-A2 (MC208415) and mouse OSM (MR226014) expression plasmids were purchased from Origene. Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14) ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... mouse anti Bcat1 (TA504360, OriGene), mouse anti-GFAP (644701 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Turbo GFP (mouse; Origene).
-
bioRxiv - Microbiology 2022Quote: ... and mouse Cd164 (Origene, #MR201951) cDNAs were cloned into EcoRV-cut plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MIC19 (TA803454, Origene) at 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LGALS9 (OTI19H8, Mouse monoclonal, Origene) at 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-TurboGFP (TA150041, Origene), mouse anti-FLAG M2 (F1804 ...
-
bioRxiv - Neuroscience 2021Quote: ... with the full-length c DNA for CCL2 (OriGene). AAV serotype 5 (AAV5 ...