Labshake search
Citations for Origene Technologies :
201 - 250 of 572 citations for Mouse Anti Human Papilloma virus types 16 18 716 D1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Neuroscience 2023Quote: The following plasmids have been used in the manuscript: human SATB1 (Origene), human GBA (Origene) ...
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Myc-DDK tagged human CD2-associated protein (RC210191) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Bioengineering 2022Quote: Anti-HER2 monoclonal antibodies were used as primary antibodies in a series of Western Blots on cellular lysates of wild-type HEK293T (non-expressing HER2) cells (Origene LY500001) and HEK293T overexpressing HER2 (Origene LY417979) ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829, Origene, Rockville MD), using PCR primers to add flanking restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number: RG227944). The primers used to clone the GFP fusion constructs for the other non-human species are shown in S9 Table ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... full length mouse CRMP4 (DPYSL3, Origene 1197294), full length CRMP5 (DPYSL5 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse AUTS2-myc-DDK in pCMV6 (OriGene) and pCGN-His-Ub (His-tagged ubiquitin expression vector ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Immunology 2022Quote: ... Human MR1 transcript variant 1 (NM_001531) cDNA clone was purchased from Origene (Rockville, MD). The constructs were then cloned into a lentiviral expression vector with a multiple cloning site separated from GFP reporter via an Internal Ribosomal Entry Site (IRES ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 1 (NM_006855) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC201571), pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: Mouse HAPLN1 cDNA was purchased (Origene, Rockville, MD) and cloned as a fusion to Venus into the pCAGGS mammalian expression plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse HSP90AB1 was purchased from Origene (TA500494). All antibodies were used at a dilution of 1:1000 unless otherwise specified ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse ALPL (MC228161) were purchased from OriGene. Cynomolgus Macaque (XM_005544525 ...