Labshake search
Citations for Origene Technologies :
401 - 450 of 564 citations for Mouse Anti Human Papilloma virus L1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Anti-La (Origene Technologies, #TA500406) was added to the post nuclear supernatant to a final concentration of 2ug/500ul and the mixture was incubated with rotation overnight at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... anti-CYP2B (Origene, Catalog# TA504328) were applied to the sections at 1:100 dilution and incubated overnight at 4□°C ...
-
bioRxiv - Physiology 2023Quote: ... anti-Mitodendra2 (TA150090) from OriGene; anti-GAPDH (GTX627408 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cytokeratin 8 (Origene BP5074), anti-Ki67-FITC (eBioscience 11-5698-90) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cancer Biology 2019Quote: Overexpression of LPL was performed using a human LPL clone in pCMV-6AC plasmid vector synthesized by OriGene (Rockville, MD; Cat. No. SC322258). An empty pCMV-6AC (“pCMV Neo” ...
-
bioRxiv - Microbiology 2020Quote: ... pRS-derived retroviral vectors expressing a scramble shRNA and shRNA targeting the mRNA of human LY6E were obtained from OriGene (Cat. No. TR311641).
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-HK2 (TA325030, 1:500, Origene), anti-LDHA (3582T ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-NOTCH1 (Origene, EP1238Y, 1:200), anti-Foxn1 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2020Quote: ... and unconjugated anti-GFP (Origene TA150070), anti-mCherry (Novus NBP2-25158) ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Genetics 2021Quote: ... chicken anti-GFAP (1:200, Origene). Secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Immunology 2022Quote: ... 30 The anti-NEU3 (TA590228, Origene) was used at 0.5 µg/mL in PBS-BSA/500 mM NaCl/0.1% NP-40 alternative (EMD Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... anti ABHD17 (1:1000, Origene TA331704), anti ABHD17 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Nav1.7 (1:500, Origene, TA329033), anti-CCT5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CCT5 (1:1000, Origene, TA308298), and anti-TMED10 (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... and goat anti-KLF1 (Origene TA305808). The beads were retrieved using a magnetic stand and rinsed with RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2019Quote: ... cells were co-transfected with a (mouse) LHX1 expression construct (Origene Technologies Inc., Rockville, MD, USA) in which Myc-DDK-tagged-LHX1 is expressed from pCMV6 ...
-
bioRxiv - Cancer Biology 2021Quote: A mouse Nup210 full length cDNA (NM_018815) encoding vector (pCMV6-Nup210-Myc) was purchased from Origene Technologies ...
-
Tumour Extracellular Vesicles Induce Neutrophil Extracellular Traps To Promote Lymph Node MetastasisbioRxiv - Cancer Biology 2023Quote: B16F10 cells were transfected with Rab27a-mouse shRNA and scramble RNA lentiviral particles purchased from Origene according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Prx3 (Origene, TA322470, dilution 1:100) and anti-CERT (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-ACAA2 (Origene Technologies, cat # TA506126). The slides were imaged using Nikon A1R laser scanning confocal microscope with Plan Apo 60x objective.
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mCherry (1:500, OriGene AB0081-500); anti-mKate2 for Brainbow 3.0 (gift of Dr ...