Labshake search
Citations for Origene Technologies :
601 - 650 of 651 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 gp41 1911 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... the corresponding horseradish peroxidase (HRP)-conjugated Goat anti-Rabbit IgG secondary antibody (Origene, Cat#PV-6002) was sequentially used for incubation at room temperature for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: NLRP1 and CARD8 transcript variant 1 DNA obtained commercially from Origene (pCMV6-entry clones RC216481 and RC230245 ...
-
bioRxiv - Neuroscience 2021Quote: ... In experiments where Neuro2A cells were stained for recombinases (Cre 1:500, EMD Millipore cat# MAB3120; Flp 1:500, Origene cat# TA160030; Figures 1B, 2B, S1, S2) the protocol was as described above ...
-
bioRxiv - Developmental Biology 2022Quote: ... the slides were incubated with goat anti-rabbit IgG conjugated to horseradish peroxidase (HRP) (ORIGENE, ZB-2301) at RT for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM DTT and 0.25 µg recombinant SLP-76 (OriGene, Cat. TP721201) were then added to the sample and incubated at 30 °C for 60 min ...
-
bioRxiv - Immunology 2022Quote: ... 1 μl from a 200 ng/μl stock of NEU1 (TP300386; Origene), NEU2 (TP319858 ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... KCNK3 (Myc-DDK-tagged) (TASK-1) (NM_002246.3) was purchased from OriGene (RC215155) and cloned into IRES2 vector using BglII/XhoI sites ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1×104 cells were mixed with mock or Igfbp2 lentivirus (catalog # MR204287L3V; OriGene Technologies) at MOI=80 in the 500 ml of 10 µg/ml polybrene/DMEM-F12 ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Microbiology 2022Quote: ... Intracellular staining of influenza A nucleoprotein was done by applying the anti influenza A (nucleoprotein) – FITC antibody (OriGene, AM00924FC-N) for 60 min at 4 °C in the dark ...
-
bioRxiv - Microbiology 2022Quote: ... Two 0.5 ml aliquots of the supernatant were then mixed with 5 μg of bead-immobilized anti-basigin (Origene TA501189) and anti-neuroplastin (R&D Systems AF7818 ...
-
bioRxiv - Genomics 2023Quote: Two biological replicates of HMLE cells were UV crosslinked and iCLIP was performed as previously described using anti-hnRNPM antibody (Origene).
-
bioRxiv - Bioengineering 2022Quote: ... A 1:60 dilution of HER2 expressing whole cell lysate in RIPA buffer (Origene LY417979), or a lysate control (Origene LY500001) ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus containing supernatant was concentrated 1:50 as described by the manufacturer (Origene, catalog # TR30026), flash frozen in liquid nitrogen and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable knockdown of FTO was achieved by lentiviral delivery (5 D.O.I) of anti-FTO sh-RNA (Origene, #TL308064, sh-FTO#B). Isolation of infected cells was performed by GFP positive cells sorting on FACSAria.
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 20 ng/ml) for 24 h in the presence or absence of 10 μg/ml polyclonal anti-NRG1 antibody (Origene, Rockville, MD), 50 μmol/L ErbB4 inhibitor AG1478 (Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... we used plasmids containing scrambled shRNA and anti-SNX27 shRNA under the CMV promoter (pCMV-scr-shRNA, pCMV-shSNX27, Origene Technologies #TL518223). All plasmid DNA were purified using the ZymoPure II (Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: ... along with 1 μg of pCMV-Entry-Empty or pCMV-Entry-ETV7 plasmid (Origene and(20)) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The KDELR3 shRNA recognition sequence was edited (t210c_c213a_t216c_t219c_a222c) from Myc-DDK-tagged KDELR3 transcript variant 1 construct (RC201571, OriGene). TOPO cloning was used to clone place this sequence into the Gateway cloning system and the pENTR L1/L2 plasmid was combined with C413-E19 pPol2 L4/R1 and pDEST-658 R4/R2 destination plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... BMP2K (1-560) and BMP2K (561-1161) were PCR amplified from the template ORF clone # RC215795 (Origene) and inserted into HindIII restriction site of pEGFP-N1 vector using In-Fusion cloning technology (Clontech ...
-
bioRxiv - Cancer Biology 2021Quote: Purified RPRM peptides (77-109, ChinaPeptides; 1 μg) were incubated with purified recombinant CDK4 (Origene; 0.2 μg) and CDK6 proteins (Origene ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP tagged plasmid with JPh44 translating region (GFP-Δ(1-240) JPh1) were created by OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... then incubation was undertaken with a primary rabbit polyclonal CSF2RA (GM-CSF receptor alpha) antibody for 1 hour (Origene TA323990S ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... we obtained a clone expressing full-length (residues 1-1106) untagged GLI1 in the pCMV6-XL5 vector backbone from OriGene Technologies (catalog number SC125780) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA sequence CTAGAGGAGGAGATCCCGTC (TGG) in exon 1 of ABI1 was cloned into a pCas-Guide-EF1a-GFP vector (cat. #: GE100018) from Origene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Neuroscience 2019Quote: ... For each construct, 1 µg DNA (wt 2N4R tau, N167Q 2N4R tau, N368Q 2N4R tau or AEP (Origene clone no. RC200309)) was used ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Microbiology 2024Quote: ... S1PR2 expression in J2 HIEs was detected by Western blot analysis using rabbit S1PR2 polyclonal antibody (1:500; #AP01198PU-N, OriGene Technologies). Villin was used as cell loading control and detected using 1:1000 dilution of mouse anti-villin (#sc-373997 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...