Labshake search
Citations for Origene Technologies :
351 - 400 of 464 citations for Mouse Anti Hepatitis C Virus NS3 Antibody 1878 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Biochemistry 2021Quote: ... The expression vectors for mouse fucosyltransferases (FUTs) and L-Fringe were obtained from Origene (supplemental Fig. S1).
-
bioRxiv - Immunology 2022Quote: ... stable cell lines were produced using commercially designed lentivirus particles targeting mouse Gsdmc2 (NM_001168274.1) and Gsdmc3 (NM_183194.3) (Origene #HC108542): shRNA HC1008542A– AGTATTCAATACCTATCCCAAAGGGTTCG ...
-
bioRxiv - Neuroscience 2022Quote: pCMV6-eEF1A1 (#MG207381) and pCMV6-eEF1A2 (#MG207396) mouse ORF clones (GFP tagged) were obtained from OriGene (USA). They were subcloned into AAV2 (shortened as AAV ...
-
bioRxiv - Developmental Biology 2023Quote: ... we amplified the Sfrp2 coding sequence from an Sfrp2 (NM_009144) Mouse Tagged ORF Clone (Origene CAT#: MR204070) using CloneAmp™ HiFi PCR Premix (Takara 639298 ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Prx3 (Origene, TA322470, dilution 1:100) and anti-CERT (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-ACAA2 (Origene Technologies, cat # TA506126). The slides were imaged using Nikon A1R laser scanning confocal microscope with Plan Apo 60x objective.
-
bioRxiv - Neuroscience 2021Quote: ... anti-mCherry (1:500, OriGene AB0081-500); anti-mKate2 for Brainbow 3.0 (gift of Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-KRT8 (Origene, BP5075; 1:300). For secondary antibody incubation ...
-
bioRxiv - Immunology 2023Quote: ... and goat anti-TdTomato (AB8181-200, Origene). The following secondary antibodies were all from Jackson ImmunoResearch unless noted ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-TMED10 (1:1000, Origene, TA306375), overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-GFP (catalog#TA150041, OriGene, Rockville, MD) at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-CSNK1G1 (IF: 1:50, OriGene, TA806333S); Anti-ROBO2 (IF ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry (Origene, Cat. No.: AB0040-200), Anti-calnexin (Abcam ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... The slides were then incubated with an HRP-conjugated secondary antibody (OriGene) for 20 minutes at RT and stained with DAB (Vector Laboratories) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were incubated overnight: TRIM24 (1:200, TA802797, Origene), TRIM33 (1:200 ...
-
bioRxiv - Physiology 2022Quote: ... Flag immunoprecipitation was performed with antibody conjugated-magnetic beads (OriGene, Rockville, MD). The following antibodies were obtained for immunoblotting ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary antibodies pan cytokeratin (PanCK, 1:100, OriGene Catalog # CF190032, Lot # F003) and vimentin (VIM ...
-
bioRxiv - Cancer Biology 2019Quote: MDA-MB-231 shRNA cells were generated through lentiviral transduction using HuSH shRNA plasmid panels (29 mer) with pGFP-C-Lenti vectors and the Lenti-vpack Packaging Kit (TR30037) according to manufacturer guidelines (OriGene Technologies, Rockville, MD). shRNA plasmids included four LPL shRNAs and a negative control (TL311692) ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...
-
bioRxiv - Immunology 2024Quote: mRNA was synthesized encompassing the open reading frame of a fusion protein coding for the full-length ANKRD55 isoform 201 coupled to C-terminal MYC-FLAG tags as provided by a commercial vector (Origene, Cat. No. RC221211). Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies ...
-
bioRxiv - Neuroscience 2020Quote: The plasmid encoding AAV-PGK-chst3 was made by amplifying the mouse chst3 sequence from plasmid MR207541 (OriGene) via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593 ...
-
bioRxiv - Biochemistry 2021Quote: ... transiently co-transfected with pcDNA3.1-FIT2/V5-His and GFP-tagged MARCH6 (BC059190) Mouse Tagged ORF Clone (Origene), were pre-treated with 10 µM MG132 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Molecular Biology 2022Quote: H9c2 cells were transfected with plasmid containing DDK-tagged mouse JCN (Accession number: NM_133723, Origene, Rockville, MD, USA) or its mutant (K8R/K102R/K107R/K140R ...
-
bioRxiv - Biophysics 2024Quote: The mouse LRMP construct in PCMV6-Kan/Neo (GenBank AAH52909.1; Cat. #MC228229, Origene, Rockville, MD; Supplementary Figure 1), HCN1 in pcDNA3 (generously provided by Dr ...
-
bioRxiv - Cancer Biology 2022Quote: The expression plasmids pCMV6-Entry-Empty and pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL3-NF-κb reporter ...
-
bioRxiv - Immunology 2023Quote: Bone marrow cells from the femurs of LB2 mice were isolated and transduced with either scrambled or Annexin A1 (Anxa1) shRNA using TR30030 pRFP-C-shLenti vector (Origene Technologies Inc. MD, USA) at an MOI of 150 ...
-
bioRxiv - Biophysics 2021Quote: ... Other antibodies used in this study are commercially available as follows (TRIM69, Origene; Fancm ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were purchased against β-actin (Origene, Rockville, MD, USA, OG-TA811000), CRMP1 (ProSci ...
-
bioRxiv - Cancer Biology 2023Quote: ... under gentle agitation and incubated overnight with antibodies against Arc/Arg3.1 (TA349500, OriGene), CD9 (ab236630 ...
-
bioRxiv - Cancer Biology 2023Quote: The following antibodies were used for western blotting: PRR14L (Origene, Rockville, MD; TA331394), HA (Proteintech ...
-
bioRxiv - Cell Biology 2020Quote: ... the anti-TFAM (TA332462, rabbit; Origene, Rockville, USA) antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
bioRxiv - Cell Biology 2021Quote: ... respectively): anti-SKAP (1ug/ml, rabbit, Origene, TA333584), anti-α-tubulin (DM1A ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:1000 Anti-DDK (FLAG) Clone 4C5 (OriGene Cat# TA50011-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFP rabbit polyclonal (Origene, TA150032, 1:10,000), anti-HA mouse monoclonal (BioLegend ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUBB3 (Origene, TA500047, 1:3,000 dilution), anti-GAPDH conjugated peroxidase (Proteintech ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-NOB1 (1:1000, Origene TA808793 clone OTI1C12), anti-phospho-Ser/Thr-Pro MPM-2 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Goat anti-Tdtomato (Origene AB8181; 1:500).
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...