Labshake search
Citations for Origene Technologies :
151 - 200 of 358 citations for Mouse Anti Chikungunya Virus E2 Protein 16A12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged mouse Suv39h1 (NM_011514) was purchased from Origene (#MG206488; Rockville, MD, USA). pEGFP-C1-human SUV39H1 was previously described [7] ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse Pla2g2a-Myc-DDK construct was obtained from Origene (m-sPLA2-IIA-myc). Mouse PGRN construct was cloned into pSecTag2B vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... or anti EGFP (Origene) primary antibody ...
-
bioRxiv - Genomics 2020Quote: ... Anti-Dendra2 (OriGene TA180094), Anti-TFIIB (Cell Signaling 4169) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-ANP32E (OriGene, TA351339), anti-H3 (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... and anti-HA (Origene) mouse monoclonal antibodies were used as primary antibodies for immunoblotting and immunoprecipitation ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-Ago2 (Origene, TA352430) and anti-ATIII antibodies ...
-
bioRxiv - Immunology 2022Quote: ... anti-NEU2 (TA324482, Origene) or (24523-1-AP ...
-
bioRxiv - Immunology 2022Quote: ... anti-NEU3 (TA590228, Origene) or (27879-1-AP ...
-
bioRxiv - Neuroscience 2023Quote: ... chicken anti-GFAP (Origene, AP31806PU-N ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Microbiology 2023Quote: ... anti-IFIT1 (#TA500948; OriGene), anti-IFITM-3 (#AP1153a ...
-
bioRxiv - Neuroscience 2020Quote: ... 100 μg of lysates or 100 ng of TDP-43 recombinant protein (NM_007375, OriGene) was incubated with 30 pmol of biotin-labelled RNA for 1 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene, cat#TP760798) in hypotonic lysis buffer (5 mM Tris ...
-
bioRxiv - Developmental Biology 2021Quote: ... The CatSper1 ORF was amplified from a mouse cDNA clone (Cat. No. MR224271, Origene). C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV6-Arc-Myc-DDK (FLAG) mouse ORF cDNA clone (MR206218) was from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 100 ng Fgf1 (NM_010197) Mouse Tagged ORF Clone (ORIGENE, MR201152) or control empty vector using Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: Knock-out was performed using the TDG mouse Gene Knock-Out kit (Origene, KN317363). This kit contained two gRNAs that targeted the first exon of TDG gene and a donor vector that contained a GFP-Puromycin cassette to facilitate the screening process ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GAPDH (2D9) and a rabbitt polyclonal anti-CEACAM1 (TA350817) antibody were from Origene. Anti-Rabbit-HRP and anti-mouse-HRP were from Cell Signalling Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and anti-ACTB (TA811000, Origene) were used for immunoblotting ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-Bcl-xL siRNAs (Origene) was diluted in jetPRIME (Polyplus transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... rabbit anti-MMP9 (OriGene, TA326652), anti-GAPDH (Santa Cruz Biotechnology ...
-
bioRxiv - Biochemistry 2019Quote: ... Anti-La (Origene Technologies, #TA500406) was added to the post nuclear supernatant to a final concentration of 2ug/500ul and the mixture was incubated with rotation overnight at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... anti-CYP2B (Origene, Catalog# TA504328) were applied to the sections at 1:100 dilution and incubated overnight at 4□°C ...
-
bioRxiv - Physiology 2023Quote: ... anti-Mitodendra2 (TA150090) from OriGene; anti-GAPDH (GTX627408 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-cytokeratin 8 (Origene BP5074), anti-Ki67-FITC (eBioscience 11-5698-90) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-PPP3CB (Origene, 1:200); anti-GRASP65 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody directed against α1-actinin (#TA500072S, IF dilution 1:100) was from Origene. Phalloidin-Alexa488 ...
-
bioRxiv - Neuroscience 2020Quote: Full-length cDNAs encoding mouse IgSF8 (BC048387) and Tenascin-R (BC138043) were purchased from Origene and Source Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Genomics 2021Quote: The Zcchc8 KN2.0 non-homology mediated mouse gene knockout kit (KN519669) was purchased from OriGene. Either the pCas-Guide CRISPR vector (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Physiology 2020Quote: The mouse clone of LRMP in pCMV6 was purchased from OriGene (Rockville, MD; Cat. #MC228229). The mouse variant of IRAG in pReceiver-M61 was purchased from GeneCopoeia (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Neuroscience 2022Quote: 1μL (1667fmol) 13C615N4-L-Arginine13C615N2-L-Lysine Stable Isotope Labeled (SIL) β4 protein standard (Origene #PH310440) was added to each sample (total=16 samples overall ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-HK2 (TA325030, 1:500, Origene), anti-LDHA (3582T ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-NOTCH1 (Origene, EP1238Y, 1:200), anti-Foxn1 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2020Quote: ... and unconjugated anti-GFP (Origene TA150070), anti-mCherry (Novus NBP2-25158) ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...