Labshake search
Citations for Origene Technologies :
301 - 350 of 385 citations for Mouse Anti Canine Parvovirus 2 Antibody 3H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... 1:1000 Anti-DDK (FLAG) Clone 4C5 (OriGene Cat# TA50011-100 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFP rabbit polyclonal (Origene, TA150032, 1:10,000), anti-HA mouse monoclonal (BioLegend ...
-
bioRxiv - Neuroscience 2021Quote: ... and anti-TUBB3 (Origene, TA500047, 1:3,000 dilution), anti-GAPDH conjugated peroxidase (Proteintech ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-NOB1 (1:1000, Origene TA808793 clone OTI1C12), anti-phospho-Ser/Thr-Pro MPM-2 (1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Goat anti-Tdtomato (Origene AB8181; 1:500).
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Biochemistry 2020Quote: ... the mGFP cDNA was inserted between the region encoding the 71st and 82nd amino acids of mouse Gαs (Origene) in the pcDNA3.1 (+ ...
-
bioRxiv - Neuroscience 2021Quote: ... SP6 transcribed antisense and T7 transcribed sense control probes were synthesized from mouse Fcgr1 (NM_010186) cDNA clone (MR225268, OriGene) using 1 set of primers (forward ...
-
bioRxiv - Physiology 2022Quote: ... coated 6-well plates (SPL Life Sciences Co., Korea) with Kcnq4 Mouse Tagged ORF Clone (OriGene, Rockville, MD, USA) using Lipofectamine LTX and Plus Reagents (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Bioengineering 2022Quote: ... Antibodies or reagents used were: (i) CD235a-PE (1:2500 dilution; OriGene cat#DM066R), CD49d-BV421 (1:100 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were probed with primary antibodies against the N-terminal fragment of YFP (Origene), Flv2 and Flv3 (Antiprot) ...
-
bioRxiv - Cell Biology 2024Quote: ... the following antibodies were used on paraffin sections: RFP (goat, Origene, cat# AB8181-200), RFP (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... MA) and antibodies against tdTomato and Ki-67 were obtained from Origene (Rockville, MD) and Abcam (Boston ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... and shRNAs against mouse DNMBP cloned into the pRFP-C-RS vector (TF515449, Locus ID 71972) were purchased from OriGene. Cdc42F28L-HA was provided by Richard A ...
-
bioRxiv - Immunology 2021Quote: The pCMV6-Ac-GFP vector containing the mouse Mt3 gene (pCMV6-Ac-MT3-GFP) and empty pCMV6-Ac-GFP vectors were acquired from Origene and dissolved in nuclease-free sterile H2O ...
-
bioRxiv - Genetics 2022Quote: ... and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536, Origene, Maryland, USA). After 24 h cells were treated with 10µM monensin and immunofluorescence analysis was done as explained above ...
-
bioRxiv - Cell Biology 2020Quote: A non-tagged construct of mouse Gdf3 was generated using the commercial vector pCMV6-Gdf3-Myc-Flag (OriGene Technologies, MR222967), containing a Myc-Flag-tagged Gdf3 ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Cancer Biology 2021Quote: CT-2A and GL261 glioma cell lines were infected with Slit2 mouse shRNA lentiviral particles (Locus ID 20563, Origene TL511128V) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The mouse Synaptophysin gene was cloned as a BamHI/NotI fragment into a modified pCMV6-AN-His vector (Origene, USA) that contains an N-terminal 12xHis tag followed by a PreScission cleavage site ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP was detected using anti-GFP antisera (TP401, OriGene).
-
bioRxiv - Biochemistry 2019Quote: ... anti-Lupus La #TA-00406 (Origene Technologies, Rockville, MD), anti-vinculin #ab129002 (Abcam) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-GABRA5 (1:200, Origene Cat# TA338505), guinea pig polyclonal anti-GAD2 (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... HAP1 cells were transfected with 2 µg lentiCRISPR v2 bearing the sgRNA of interest in the presence of transfection reagent Turbofectin 8.0 (OriGene). Transfected cells were selected with 2 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Immunology 2019Quote: ... 31) and myc-FLAG-tagged Syncytin-1 and 2 expression constructs in the pCMV6 vector were purchased from Origene. pFR-Luc and pBD-NFkB (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... for testing were co-transfected with Renilla control plasmid (20 ng) and either a plasmid containing mouse Tbx1 cDNA (200 ng, Origene, PS100001) or empty vector control (200ng ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene, #TA150041); for western blot ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Neuroscience 2020Quote: ... or Guinea Pig anti-CK20 (Origene Tech, Germany, 1:200). Secondary antibodies used were anti-rabbit Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and polyclonal anti-rabbit IgG (1:5000, R1364HRP, OriGene, Germany). Proteins were detected using chemiluminescence HRP substrate (Merck) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rabbit anti-EMX1 (Origene, TA325087, WB 1:1000 in BSA), rabbit anti-BLBP (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... and b) rabbit polyclonal anti-GLP-1R (1:50; Origene) and mouse monoclonal anti-GFAP antibody (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 1 μg of anti-flag (α-DDK, TA50011, Origene) in 1 ml of lysis buffer containing 1 mg of total protein extract ...
-
bioRxiv - Biophysics 2023Quote: ... Primary anti-DDK immunoglobulin [TA50011-100] was obtained from OriGene Technologies Inc ...
-
bioRxiv - Physiology 2023Quote: ... Rabbit polyclonal anti-human C12orf23 (TMEM263) was from Origene (TA333490). Mouse monoclonal JAK2 (C-10) ...
-
bioRxiv - Cancer Biology 2021Quote: Cxcl5 (NM_009141) Mouse Tagged ORF Clone Lentiviral Particles containing 107 transduction units/ml were purchased from Origene (Cat no: MR200761L4V; Rockville, MD). 50 μl of lentiviral suspension was added to sub-confluent KRC line in a single well of a 24-well plate containing 200 μl of complete media ...
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Molecular Biology 2024Quote: Trastuzumab light chains 1 and 2 were obtained by Tebubio Srl and cloned in the CD81-GFP vector (OriGene, 7268 bp), obtaining the antiHER2 construct (CD81-antiHER2-GFP ...
-
bioRxiv - Genetics 2023Quote: ... SMCs were stained with anti-ZC3HC1 (Origene, AP20366PU-N, 1:100), anti-Tubulin (abcam ...
-
bioRxiv - Immunology 2019Quote: Plasmids of the wild-type mouse Mul1 (pMul1-FLAG) and Asc (pAsc-Myc) were constructed using pCMV6 Mul1-Myc/DDK (MR205346, Origene, Rockville, MD, USA) and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler ...