Labshake search
Citations for Origene Technologies :
201 - 250 of 571 citations for Mac 1 SAP mouse human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... full length mouse CRMP4 (DPYSL3, Origene 1197294), full length CRMP5 (DPYSL5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse AUTS2-myc-DDK in pCMV6 (OriGene) and pCGN-His-Ub (His-tagged ubiquitin expression vector ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Neuroscience 2021Quote: Membranes were blocked for 1 hour at room temperature with Odyssey blocking buffer (Li-Cor, Lincoln, NE, USA) and were then incubated with mouse anti-TurboGFP (1:2000; Origene, Rockville, MD, USA) and rabbit anti-β-tubulin (1:5000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse HSP90AB1 was purchased from Origene (TA500494). All antibodies were used at a dilution of 1:1000 unless otherwise specified ...
-
bioRxiv - Neuroscience 2023Quote: Mouse HAPLN1 cDNA was purchased (Origene, Rockville, MD) and cloned as a fusion to Venus into the pCAGGS mammalian expression plasmid ...
-
bioRxiv - Developmental Biology 2024Quote: ... Lmx1b Mouse Tagged ORF Clone plasmids (ORIGENE, MG226016) were transfected using Lipofectamine LTX Reagent with PLUS Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse ALPL (MC228161) were purchased from OriGene. Cynomolgus Macaque (XM_005544525 ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Cell Biology 2020Quote: ... THP1-derived macrophages were transfected with 10 nM siRNA targeting human TRPM7 (SR310261, OriGene, USA) following the manufacturer’s instructions using siTran1.0 (OriGene ...
-
bioRxiv - Molecular Biology 2020Quote: A human cDNA panel covering 48 major tissues was obtained from Insight Biotechnology (Origene HMRT104). Two RIF1 splicing variants were amplified by competitive PCR using a single primer pair (LW030 and LW031) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... the full length of FOXM1B was amplified from FOXM1 (NM_202003) Human cDNA Clone (#SC128214, Origene) then fused with the pBMN DHFR(DD)-mVenus ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Developmental Biology 2019Quote: A mouse KLF4-GFP vector (RG206691) obtained from Origene and KLF4(S132A)-GFP mutant published in Dhaliwal et al ...
-
bioRxiv - Microbiology 2019Quote: ... Mouse G3BP1 was subcloned from pCM6-G3BP1 (MR207441; Origene). Mouse G3BP1 lentiviral constructs deficient in the C-terminal RGG domain (mG3BP1ΔRGG ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs (27mers) targeting mouse PURB were purchased from ORIGENE, and siRNA transfection was done using Lipofectamine 2000 following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-Myc (9E10) Ab was from Origene (USA); Rabbit anti-GM130 was from Abcam (United Kingdom) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody against Trim39 was from Origene (#TA505761). Rabbit polyclonal antibody against Trim39 was from Proteintech (#12757-1-AP) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Znt3 mouse mAb (#TA501498, Origene Technologies, Rockville, MD), and anti-Znt4 rabbit pAb (#PA5-80028 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse OSM expression plasmid (MR226014) was purchased from Origene. Mouse STAT3-Y705F plasmid was kindly provided by Prof ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse monoclonal anti-BAG5 (CF810618) was purchased from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Mouse RBM3 gene from RBM3-PUC plasmid (Origene MC203679) was cloned into pMIG-GFP plasmid by restriction digestion method using Bgl2 and EcoR1 (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-LGR5 mouse mAb (TA503316S, Origene, Rockville, MD, USA), anti- Keratin20 Rabbit mAb (#13063 ...