Labshake search
Citations for Origene Technologies :
1 - 50 of 407 citations for MBL 2 MBP C Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Biochemistry 2022Quote: D-cysteine transport experiments were performed in HEK293 cells transiently transfected with human SLC1A15 (ASCT2; Origene; Cat# RC200305) and rat SLC7A10 (Asc1 ...
-
bioRxiv - Genetics 2020Quote: ... PRUNE1 levels in overexpressing HEK293 and in human fibroblasts were analyzed by immunoblotting using anti-PRUNE1 (Origene; TA344725) and/or anti-HA (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid containing human Sirt3,102-399 (pEX-His-hSIRT3,102-399) was purchased from OriGene (Rockville, molecular dynamics).
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Zoology 2023Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV6-Entry containing the human SLC44A2 cDNA C-terminally fused to EGFP was purchased from OriGene. To introduce the rs2288904 SNP encoding a R154Q substitution ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Pathology 2022Quote: HEK293 cells were transiently transfected with overexpressing plasmids for IL-31RA (Origene, RC218212L1) and CHRM3 (Origene ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transduced using the LentiORF® clone of CIITA (OriGene RC222253L3). The cells were selected using puromycin selection marker for 2 passages over the period of 7 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... were transformed by heat shock in 42°C water bath using SETD2 Human Tagged ORF Clone (Origene, RG224760) or pCMV6□AC□GFP Mammalian Expression Vector (Origene ...
-
bioRxiv - Cancer Biology 2020Quote: Control cell plugs were made by transfecting PC3 cells with C-kit Variant 1 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Microbiology 2019Quote: ... The lentiviral expression plasmid pLenti-C-Myc-DDK harboring the human vimentin gene (NM_003380, pLenti-VIM) was obtained from Origene. To generate lentiviruses ...
-
bioRxiv - Cell Biology 2023Quote: ... The expression construct for human LIS1 (RefSeq: NM_000430) fused with a C-terminal FLAG epitope tag was obtained from OriGene. An iRFP670 expression plasmid (synthesised by Azenta Biosciences ...
-
bioRxiv - Developmental Biology 2022Quote: Lenti-X 293T cells were transiently transfected with a CITED2 (NM_001168388) human c-Myc and DYKDDDDK (DDK) tagged open reading frame clone (RC229801, Origene) using Attractene in DMEM medium supplemented with 100 U/ml penicillin ...
-
bioRxiv - Cancer Biology 2024Quote: The pCMV6-AC-IGFBP2-GFP expression vector encoding human IGFBP2 (NM_000597) fused to the GFP in the C-terminal region was purchased from Origene Technologies (#RG202573) ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were stably transfected with either empty vector (pCMV6) or Sox9 expression vector (Origene). These cells were then utilized for promoter luciferase reporter assays using methods reported in our recent studies (31,61) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293 cells were stably transfected with HA-MOP and GFP-conjugated GIRK2 channel plasmids (OriGene). The cells were then seeded in 96-well plates and allowed to grow at 37°C in 5% CO2 for 48 h ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: Constructs of individual c-myc tagged human TRAP subunits (α, β, δ) under the CMV promotor were purchased from OriGene Technologies (#RC202408 ...
-
bioRxiv - Biochemistry 2022Quote: Lentiviral pGFP-shHKII vector encoding human shRNAHKII (Cat# TL312415) and non-silencing control pGFP-C-shLenti vector (Cat#: TR30023) were purchased from OriGene Technologies Inc (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Genetics 2020Quote: Thymidine Kinase 2 Human Untagged Clone (NM_004614) containing the cDNA for transcript variant 1 was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... Bach1 and Bach2 antibodies were verified with overexpression in HEK293 cells and shRNA (plasmids purchased from Origene) knockdown of endogenous protein in HEK293 cells for Bach1 and differentiated IMR-32 cells for Bach2 (data not shown) ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...