Labshake search
Citations for Origene Technologies :
1 - 50 of 122 citations for Lupatadine fumarate EP Impurity C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... specific shRNA-expressing plasmids (pGFP-C-shLentiSLAMF7 and pGFP-C-shLentiSLAMF7, Origene), with pCMV-VSV-G envelope plasmid and pCMV-dR8.91 Gag and Polymerase expression plasmid (kind gifts of M ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-mGFP (Origene). The reaction mix was filled up to 104 μl with OptiMEM (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Scrambled vector sh-Control (sh-C) was purchased from OriGene (pGFP-C-sh-Lenti, TR30021). Lentiviral packaging constructs PAX2 (12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... pLenti-TDP-43WT-C-mGFP (Origene), and pLenti-TDP-434FL-C-mGFP ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Neuroscience 2024Quote: ... or KIF11-shRNA-C (Origene TG501174). After 24-48hrs of transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... C-terminally mGFP-tagged human NRAS in pLenti-C-mGFP was purchased from OriGene (OriGene cat# RC202681L2). C-terminal mGFP was removed and eGFP tag was cloned onto the N-terminus after aberrant localization was observed upon expression in MV3 cells (presumably due to steric inhibition of C-terminal palmitoylation and farnesylation domains by the C-terminal mGFP tag) ...
-
bioRxiv - Cell Biology 2023Quote: ... was pGFP-C-shLenti also from Origene.
-
bioRxiv - Molecular Biology 2021Quote: ... two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C, SCR siRNA Origene SR30004 and POLYPLUS INTERFERIN #409-10 as Transfection reagent).
-
bioRxiv - Cancer Biology 2020Quote: BT088 cells were transduced with 4 SMPD3 human shRNA lentiviral particles (A,B,C,D) and Lenti shRNA Scramble control particles (pGFP-c-shLenti; TL301492V; Origene). Transduced GFP+ cells (shSMPD3-GFP variants B,D and shScrambled-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... pGFP-C-shLenti scrambled negative control (TR30021), and pGFP-C-shLenti Lphn3 shRNA-D (GTATGTTGGCTTCGCCTTGACACCTACTT, custom) were purchased from Origene.
-
bioRxiv - Cancer Biology 2021Quote: ... pLenti-TRIM9-C-Myc-DDK-P2A-Puro (Origene), pLenti-TRIM9-C-mGFP (Origene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-mGFP-P2A-puro-FGF19 (Origene, RC203750L4), EdTP (dominant negative Tcf4 ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... with the full-length c DNA for CCL2 (OriGene). AAV serotype 5 (AAV5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were incubated 4 °C overnight with anti-DDK (Origene) and anti-mouse Ki67 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses expressing pLenti-C-Myc-DDK-IRES-Neo (OriGene, empty vector) or vector with encoded WT CDKL5 (NM_001323289.2) ...
-
bioRxiv - Neuroscience 2022Quote: ... or pLenti-TDP-43ΔNLS/2KQL-C-mGFP (Origene, mutations by GenScript). Cells were seeded onto coverslips in 24-well plates at a density of 25,000 cells/well and incubated for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids pGFP-C-shLenti encoding shCYP27A1(TL313602) were from OriGene (OriGene Technologies GmbH ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus transduction for mGFP (pLenti-C-mGFP-P2A-Puro - Origene Cat# RC211875L4V), CLU_mGFP (CLU(mGFP-tagged)- human clusterin(CLU ...
-
bioRxiv - Physiology 2024Quote: ... and Nalcn shRNAs were cloned into the pGFP-C-shLenti vector (OriGene) and co-transfected with pMD2.G and psPAX2 (Addgene ...
-
bioRxiv - Physiology 2024Quote: ... and Slit3-C sequences were cloned from a cDNA clone (Origene MR225499L4) and cloned into the pAAV-hAdiponectin-W backbone38 using NEBuilder HiFi DNA Assembly kit using the following primers:
-
bioRxiv - Cancer Biology 2020Quote: ... Cells transduced with the empty pLenti-C-mGFP-P2A-Puro vector (PS100093, OriGene), (HT29GFP and Caco2GFP ...
-
bioRxiv - Microbiology 2020Quote: Vectors expressing C-terminally FLAG-tagged ATP6V0C and ATP6V0C” were obtained from OriGene Technologies Inc ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...
-
bioRxiv - Cell Biology 2023Quote: ... The spectrin-silencing shRNA plasmids were constructed in the pRFP-C-RS backbone (Origene). These plasmids allow cloning and expression of shRNA under a U6 promoter and co-expression of the TurboRFP red fluorescent protein under the control of a CMV promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... oeELF3: Human hELF3 (NM_004433) in pLenti-C-Myc-DDK-P2A-Puro was purchased (OriGene Technologies ...
-
bioRxiv - Microbiology 2021Quote: The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-Directed Mutagenesis Kit (Cat# 200521 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product and the plasmid pLenti-C-mGFP (# PS100071 OriGene Technologies, Rockville, MD, USA) were digested with Asc1 (#R0558L Bioconcept ...
-
bioRxiv - Microbiology 2023Quote: ... The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-directed mutagenesis kit ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplicons were ligated into AscI and NotI digested pLENTI-C-mGFP (#PS100071, OriGene, Rockville, MD, USA) according to standard procedures ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... and Ser5 and murine Ser4 that express a C-terminal FLAG tag were purchased from Origene, and the Ser1 ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...