Labshake search
Citations for Origene Technologies :
151 - 200 of 486 citations for Human Xylosyltransferase 1 XYLT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant human Lsm12-expression plasmids were obtained either commercially (pCMV-Lsm12-Myc-FLAG from OriGene) or were constructed with pcDNA6 (pCDNA6-Lsm12-FLAG-His) ...
-
bioRxiv - Cell Biology 2020Quote: ... THP1-derived macrophages were transfected with 10 nM siRNA targeting human TRPM7 (SR310261, OriGene, USA) following the manufacturer’s instructions using siTran1.0 (OriGene ...
-
bioRxiv - Molecular Biology 2020Quote: A human cDNA panel covering 48 major tissues was obtained from Insight Biotechnology (Origene HMRT104). Two RIF1 splicing variants were amplified by competitive PCR using a single primer pair (LW030 and LW031) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Biochemistry 2023Quote: Human cell derived recombinant eIF2A-FLAG was expressed in HEK293T cells obtained commercially (OriGene # TP304303) and buffer exchanged into Protein Storage Buffer (25 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... the full length of FOXM1B was amplified from FOXM1 (NM_202003) Human cDNA Clone (#SC128214, Origene) then fused with the pBMN DHFR(DD)-mVenus ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: The vector expressing myc-DDK-tagged-human wt DDX6 was purchased from OriGene (RC209431, Rockville, MD). The helicase-deficient DDX6 E247A mutant was constructed by overlapping PCR using primers oVM506 5’-ACTTATCTGCCGCATCCAATACTATCATCTGGACATGAT-3’ and oVM507 5’-TTGGATGCGGCAGATAAGTTGCTGTCACAGGATTTTGTG-3’ ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser126 to Arg in GPT and Ser153 to ARg in GPT2 was performed with the Q5 site-directed mutagenesis kit frm NEB (#E0554).
-
bioRxiv - Cell Biology 2019Quote: ... pCMV6-Entry containing the human SLC44A2 cDNA C-terminally fused to EGFP was purchased from OriGene. To introduce the rs2288904 SNP encoding a R154Q substitution ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Biophysics 2021Quote: ... DNA encoding ctSTIM1 (aa 233-685) was amplified by PCR from full-length human STIM1 (Origene), appending an N-terminal NcoI cleavage site ...
-
bioRxiv - Cell Biology 2021Quote: Cells were transiently transfected with a human KLK10-encoding plasmid (pCMV6-KLK10-Myc-DDK; Origene RC201139) at 0.1-1 μg/mL or as a control a GFP plasmid (PmaxGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified human AXIN1-MYC/DDK (TP308349) and TPX2-MYC/DDK (TP305821) proteins were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Physiology 2020Quote: ... Human Flag- and myc-tagged GPT and GPT2 cDNA was obtained from Origene (RC203756 and RC209119). Mutagenesis of Ser125 to Arg in GPT and Ser153 to Arg in GPT2 17 was performed with the Q5 site-directed mutagenesis kit from NEB (#E0554) ...
-
bioRxiv - Cancer Biology 2021Quote: ... shSlit2 CT-2A cells were infected with SLIT2 (NM_004787) Human Tagged ORF Clone Lentiviral Particle (Origene) in accordance with manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Genes encoding NL-Gal3 (IDT, Coralville, IA, USA) and recombinant human Gal3 (OriGene, Rockville, MD, USA) were inserted into pET-21d(+ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HEK293-Null2 cells were also co-transfected with a human MD-2 expression clone (OriGene, RC204686). JetPRIME (Polyplus ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... The human full-length Mtss1 expression construct was purchased from Origene (pCMV6-hMtss1, Cat# RC218273, USA), and Myc-tagged Mtss1 deletion constructs (Mtss11I-BAR [amino acids deleted ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cancer Biology 2019Quote: ... The TissueScan™ Tissue qPCR Array containing cDNAs for human lymphoma I-II was purchased from Origene. Relative expression of Rictor was determined using inventoried Taqman probes and PCR master mix from Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Cancer Biology 2021Quote: ... THEM6 human tagged ORF clone overexpressing plasmid and respective control (RC201709 and PS100001, Origene, Rockville, MD, USA) were purchased from Origene ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP cells were transfected with SLFN5 (NM_144975) Human MYC-Tagged ORF Clone (RC216330, Origene, Rockville, MD, USA) or the corresponding empty vector plasmid (PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...