Labshake search
Citations for Origene Technologies :
1 - 50 of 348 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
-
bioRxiv - Cell Biology 2024Quote: ... All qPCR primer pair sequences were from OriGene (Rockville, MD).
-
bioRxiv - Bioengineering 2024Quote: ... Primers used in this study were purchased from Predesigned qPCR Assays (Integrated DNA Technologies) or qPCR Primer Pairs (OriGene Technologies, Inc.).
-
bioRxiv - Immunology 2024Quote: ... Specific qPCR primers for human LRP1 were obtained from OriGene (#HP206040). Specific qPCR primers for human GAPDH were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Immunology 2022Quote: ... Gene-specific PCR primer pairs were obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR primers were from Origene (MyoVa Fw - CTCACACGAACTCCTGCAAA ...
-
bioRxiv - Immunology 2022Quote: ... the following qPCR primers (Origene) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Cell Biology 2021Quote: ... QPCR primer sequences were obtained from OriGene website ...
-
bioRxiv - Genomics 2023Quote: ... qPCR primer sequences were provided by OriGene or designed by PrimerQuest™ Tool from Integrated DNA Technologies (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers targeting beta-Actin (ACTB) (NM_001101) were obtained from Origene (Cat. No. HP204660) and included as the reference gene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Some qPCR primers were purchased from Origene (Table S3). Cycle threshold values were normalized to those of the housekeeping genes GAPDH ...
-
bioRxiv - Cell Biology 2021Quote: ... and human normal brain tissue qPCR array (OriGene Technologies, HBRT101) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Immunology 2024Quote: For Western blotting and ELISA assays, human glutaredoxin 3 (GLRX3, catalog # TP302731) and human Tropomodulin1 (TMOD1, catalog # TP301134) were obtained from OriGene Technologies Inc ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) was performed on cDNA panels of 48 healthy human tissues (OriGene Technologies, Rockville, MD) and TNBC cell lines using MX3000 (Taqman probes ROPN1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Immunology 2022Quote: ... Primers designed by Origene and span at least one intron-exon boundary ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Primers were purchased from Origene Technologies (Rockville ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers were acquired from OriGene and the following sequences for NOX2 (Mus musculus Cybb ...
-
bioRxiv - Cell Biology 2024Quote: Primers were obtained from OriGene Technologies Inc and commercially synthesized (Custom DNA Oligos ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Ready-to-use primers from Origene for ApoE (HP200028) ...
-
bioRxiv - Cell Biology 2020Quote: ... Pre-designed primers were purchaced from OriGene Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers for ACE2 were obtained from Origene.
-
bioRxiv - Neuroscience 2024Quote: ... while PLK3-HEK293 cells were produced by transfection of wild-type HEK293 cells with Myc-DDK-tagged human polo-like kinase 3 (PLK3; # RC203352, OriGene, MA, USA). All experimental procedures conducted on these cell lines were approved by the University of Sydney Institutional Biosafety Committee (#21E012).
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Cell Biology 2023Quote: ... The sequences for the primers were obtained from Origene and primers were obtained from Metabion ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... Primer sequences were obtained from Origene (MP208179, MP200232 and MP212857). Primer efficiency was calculated and incorporated in the ΔΔCt method analysis [18].
-
bioRxiv - Immunology 2023Quote: ... 0.75 μl of the forward and reverse primer (OriGene, HP205798), and 10.75 μl of RNase-free water were added to each reaction well followed by 1μl of cDNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Gene-specific primers were designed using Primer3 or obtained from Origene. Sequences are listed in Table 1.
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);