Labshake search
Citations for Origene Technologies :
1 - 50 of 352 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... the full-length human INF2-CAAX isoform was cloned into a Turbo RFP plasmid (N-terminal RFP) (Origene, MD). For GFP-tagged constructs ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
bioRxiv - Biophysics 2023Quote: ... or N1β with an N-terminal tGFP tag (custom plasmid from Origene) by Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... recombinant human HMGB2 (C-terminal His tag, TP720732) from ORIGENE (Rockville, MD); anti-rabbit alkaline phosphatase-linked antibody ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
bioRxiv - Immunology 2024Quote: For Western blotting and ELISA assays, human glutaredoxin 3 (GLRX3, catalog # TP302731) and human Tropomodulin1 (TMOD1, catalog # TP301134) were obtained from OriGene Technologies Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Physiology 2023Quote: Mammalian expression plasmid encoding human TMEM263 with a C-terminal epitope tag (Myc-DDK) was obtained from Origene (RC203933). Control pCDNA3.1 empty plasmid was obtained from Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: The pCMV6-AC-IGFBP2-GFP expression vector encoding human IGFBP2 (NM_000597) fused to the GFP in the C-terminal region was purchased from Origene Technologies (#RG202573) ...
-
bioRxiv - Cell Biology 2023Quote: ... The expression construct for human LIS1 (RefSeq: NM_000430) fused with a C-terminal FLAG epitope tag was obtained from OriGene. An iRFP670 expression plasmid (synthesised by Azenta Biosciences ...
-
bioRxiv - Biochemistry 2023Quote: Plasmid pCMV6 encoding cDNA for human RHBDL2 and RHBDL4 with a C-terminal myc-FLAG tag was obtained from OriGene, USA ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lentivirus concentration was quantified by Lenti ELISA Kit (Origene). After 16h ...
-
bioRxiv - Immunology 2024Quote: ... C-terminal flag-tagged ZFP36L2 (Origene) was cloned into the pMIG-W vector (67 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length, human, wild-type GALC cDNA (SC120078, NM_000153) was originally purchased from Origene (Rockville, MD). The cDNA was subcloned into the pBApo-CMV pur expression vector at the XbaI and PstI sites (Takara Bio ...
-
bioRxiv - Physiology 2023Quote: ... were transiently transfected as described above with a plasmid encoding C-terminal Myc-FLAG epitope-tagged human TMEM65 (TMEM65-Myc-FLAG) (Origene #RC207368; NM_194291). Cells were transfected with empty pCMV6-Entry vector (Origene #PS100001 ...
-
bioRxiv - Cell Biology 2021Quote: rKLK10 (500 ng, described above) was incubated with wild-type human recombinant (rHTRA1) (500 ng, Origene TP322362) or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208 ...
-
bioRxiv - Neuroscience 2022Quote: ... Myc-DDK tagged wild type human α-synuclein (Myc-α-SYN) plasmid constructs were purchased from OriGene technologies ...
-
bioRxiv - Genetics 2024Quote: The plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) was obtained from Origene (#RG221644, NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Cell Biology 2023Quote: ... Human siRNA Oligo Duplex for N-Cadherin (SR300716) and α-Catenin (SR301060) were purchased from Origene. siRNA was transiently transfected to the cells through Lipofectamine RNAimax (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: Wild-type human TREM2 (hTREM2) and DAP12 (hDAP12) were subcloned in pCMV6-A vector (Origene, Rockville, MD, USA). A single C→A nucleotide polymorphism (SNP ...
-
bioRxiv - Immunology 2021Quote: pCMV6-Entry vector encoding Myc-DKK-tagged human wild type (WT) ATAD3A cDNA (NM_018188.4, Q9NV17-1) was obtained from Origene and mutations were inserted by site-directed mutagenesis using the Q5 kit (E0554S ...
-
bioRxiv - Cell Biology 2024Quote: A plasmid encoding wild-type human COL2A1 (variant IIB, consensus sequence) fused to GFP was obtained from Origene (#RG221644; NM_033150). The C-terminal GFP tag was removed and replaced by a stop codon ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Physiology 2021Quote: ... and with 300 ng of cDNA plasmid encoding wild-type or mutant human TRPA1 (pCMV6-XL4 vector, OriGene Technologies, Rockville, MD, USA). The cells were used 24–48 h after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... while PLK3-HEK293 cells were produced by transfection of wild-type HEK293 cells with Myc-DDK-tagged human polo-like kinase 3 (PLK3; # RC203352, OriGene, MA, USA). All experimental procedures conducted on these cell lines were approved by the University of Sydney Institutional Biosafety Committee (#21E012).
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Cell Biology 2020Quote: ... and (iii) ZNF416-FLAG (Origene, Inc). Using Lipofectamine 3000 ...
-
Mapping chromatin state and transcriptional response in CIC-DUX4 undifferentiated round cell sarcomabioRxiv - Cancer Biology 2023Quote: ... CIC (Origene AP50924PU-N,), ETV5 (Cell Signaling 16274) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we used NSMase2 (SMPD3) Human shRNA Plasmid Kit (Origene, Locus ID 55512), which included what we termed shSMPD3 variants A-D and shScr ...
-
bioRxiv - Bioengineering 2022Quote: ... Wild-type HEK293T lysate (Origene LY500001) or HEK293T overexpressing HER2 (Origene LY417979 ...
-
bioRxiv - Microbiology 2022Quote: ... and ADK5b (Origene, AM09121PU-N). VLPs were adhered to the ELISA plate ...
-
bioRxiv - Cell Biology 2021Quote: ... hICMT (clone Origene n°RC207000) and hPFKFB4 (clone Origene n°RC201573 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Cell Biology 2021Quote: ... and hPFKFB4 (clone Origene n°RC201573) were inserted in-frame into the MaMTH bait destination vector ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cancer Biology 2020Quote: ... The IFIH1 gene was deleted using a MDA5 (IFIH1) Human Gene Knockout Kit (OriGene, KN415661) according to the manufacturer’s instructions with target sequences (5’-CTGGATGTACATTTTCACCC-3’).
-
bioRxiv - Cell Biology 2024Quote: U251 TMX2 KO cells were generated with the TMX2 Human Gene Knockout Kit (OriGene, KN400032). The pCas-Guide vector (OriGene ...
-
bioRxiv - Genetics 2024Quote: ... synaptopodin (AP33487SU-N, 1:200; Origene, MD), cortactin (MA5-15831 ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... and Ser5 and murine Ser4 that express a C-terminal FLAG tag were purchased from Origene, and the Ser1 ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Microbiology 2024Quote: ... for influenza A/PR/8/34 (H1N1) (type A NP) and B/Lee/40 (type B NP) in a pCMV-Entry vector (OriGene Technologies, Rockville, MD), were individually subcloned using AscI and Mlu I restriction sites into the bacterial expression vector pEx-N-Hi ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...