Labshake search
Citations for Origene Technologies :
151 - 200 of 366 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein DHX36 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were blocked with protein block (OriGene) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human YBX1 with a C-terminal FLAG-tag was purchased from OriGene Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number: RG227944). The primers used to clone the GFP fusion constructs for the other non-human species are shown in S9 Table ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and stained with 1:2000 HRP-conjugated anti-human ACE2 (clone OTI1D2, Origene) or 1:5000 HRP-conjugated donkey anti-human IgG (Jackson Immuno Research ...
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Molecular Biology 2023Quote: The c-Myc tagged human Gab1 cDNA clone (RC209622) was purchased from Origene, USA ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Microbiology 2020Quote: ... TRAF6 or MEKK3 proteins were purchased from Origene, as well as siRNA No Target ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Molecular Biology 2022Quote: HNRNPH1 full-length protein was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... and NICD: Mdm2 (MDM2 protein Gln119-Leu438 Origene TP761916 ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human C-terminally Myc-FLAG-tagged ZDHHC20 (C-FLAG-D20) was purchased from Origene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...