Labshake search
Citations for Origene Technologies :
501 - 550 of 552 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-C-Myc-DDK (RC210158L1; carrying the ORF of human CX36; GJD2; NM_020660) was obtained from Origene (Rockville, Md, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... each cell line (PEA1 and PEO1) was transfected using Fugene® with the following overexpressing plasmids: ZMAT3 (RC202508, Origene), GPR171 (RC207757 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was inserted into PX459 V2.0 plasmid and transfected into U2OS and HAP1 cells with GenJet-OS (SignaGen) and Turbofectin (Origene) respectively according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid encoding GFP-tagged TRIM72 (GFP-MG53) and the corresponding empty vector (GFP-Turbo) were purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Genomics 2021Quote: 2µg of targeting sgRNA plasmids were transfected (separately for the sgRNA targeting the same gene) using turbofectin (Origene, TF81001) following the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... When cells reached ∼80% confluency cells were transiently transfected with NDUFAF1(NM_016013) C-Myc/DDK-tagged plasmid (Origene #RC200029) with Lipofectamine 3000 (Thermo #L3000001 ...
-
bioRxiv - Physiology 2020Quote: ... A pCMV6-myc-DDK-Fbxl22 full-length cDNA (GenBank Accession Number: NM_175206) plasmid was purchased from Origene (Rockville, MD). The full-length Fbxl22 variant was termed Fbxl22-236 in this study ...
-
bioRxiv - Neuroscience 2021Quote: ... 200.000 cells were resuspended in the nucleofection solution containing 800 ng plasmid DNA (SC118279, Origene, or eGFP in pcDNA3.1) and analysed after 72 h.
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... the coding sequence without stop codon was amplified by PCR from the Myc-DDK-tagged CDK5RAP3 (tv3) plasmid (Origene Technologies ...
-
bioRxiv - Biophysics 2023Quote: HEK cells were transfected with plasmid encoding the +SS4 isoform of N1β with a C-terminal tGFP tag (Origene) (HEK-N1β ...
-
bioRxiv - Physiology 2023Quote: ... PGC1α or HNF4α overexpression was induced using plasmids from Addgene as gifts from Toren Finkel (#10974)31 and Gerhart Ryffel (#31100).32 QPRT plasmid was purchased from Origene (RC202960). Plasmids were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... and Porcine (XM_021097682) ALPL expression plasmids were cloned into the EcoRI and XbaI restriction sites of the PCMV6-AC (Origene) using gBlocks (Integrated DNA Technologies ...
-
bioRxiv - Biochemistry 2020Quote: The cDNA encoding full-length human SNED1 (fl-SNED1) cloned into pCMV-XL5 (clone SC315884) was obtained from Origene (Rockville, MD). The cDNA encoding full-length murine Sned1 cloned into pCRL-XL-TOPO (clone 40131189 ...
-
bioRxiv - Neuroscience 2020Quote: Neurons were transfected at 12 days in vitro (DIV) with PSD95-GFP (a kind gift from David Bredt [49] and FLAG-tagged Human SRXN-1 (purchased from Origene: RC207654) for 5 h using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Genetics 2022Quote: ... For WDR34p.Arg183Trp and WDR34p.Gly394Ser mutants cells were transfected with WDR34 human Myc-DDK-tagged tagged ORF Clone (RC204288, OriGene, Rockville, Maryland, USA) and for WDR60p.Ala911Val mutant cells were transfected with WDR60 Mouse Myc-DDK-tagged tagged ORF Clone (MR217536 ...
-
bioRxiv - Cancer Biology 2022Quote: GCN2 and ATF4 knock-out cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5’-AATTTAGTTTTGTACCCTCA-3’ ...
-
bioRxiv - Neuroscience 2020Quote: pLenti-C-Myc-DDK (control) and human PLCγ2-myc-DDK (WT) in pLenti-C backbone vectors were obtained from OriGene (PS100064, RC200442L1). PLCγ2-myc-DDK was subjected to site-directed mutagenesis (QuikChange Lightning Multi Site-Directed Mutagenesis Kit ...
-
bioRxiv - Physiology 2023Quote: ... containing the CMV promoter in front of the human FHF2-VY cDNA (NCBI Reference Sequence NM_001139500, full-length cDNA clone purchased from Origene, Rockville, MD) silently mutated in the sequence targeted by the FHF2 shRNA ...
-
bioRxiv - Molecular Biology 2023Quote: The protein-nucleosome binding assays were carried out by incubating the purified nucleosome libraries described above and human full-length KLF4 (Origene TP306691), OCT4 (Origene TP311998) ...
-
bioRxiv - Genetics 2023Quote: ... were suspended in 400 µl of standard culture media lacking penicillin/ streptomycin and either 20 µg of pCMV6-AC-GFP human SOX11 (NM_003108; Origene, Maryland, US) or pCAG-eGFP (Liew et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... MG87.TRKA and MG87.TRKB cells were transfected with PTPσ (RefSeq number NM_019140) Myc-DDK-tagged open-reading frame (ORF) plasmid purchased from OriGene (#RR209636), pCMV6-Entry vector with C-terminal Myc-DDK Tag (#PS100001 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were transfected in 12-well plates via reverse transfection where purified empty or FLAG-tagged METTL7B overexpression plasmids (Origene) were mixed with P3000 reagent in OptiMEM at room temperature followed by Lipofectamine 3000 ...
-
bioRxiv - Molecular Biology 2022Quote: ... each well was transfected with 1 μg total dciCas9-VPR and CXCR4 sgRNA plasmids (450 ng dciCas9-VPR, 450 ng CXCR4 sgRNA, 100 ng mCherry control) using Turbofectin (Origene) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... The NAA10-Myc plasmid was constructed by subcloning of a Myc-His tag to replace the Myc-DDK tag in the hNAA10-Myc-DDK plasmid (RC201354, OriGene). The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912 ...
-
bioRxiv - Physiology 2023Quote: ... The SIK3-Flag plasmid was constructed by subcloning of a 3xFlag tag to replace the Myc-DDK tag in the mSIK3-Myc-DDK plasmid (MR211912, OriGene). SIK3-Flag-ΔPKA (ΔPKA ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: ... The number of MT-ATP6 copies per microliter was determined based on a standard curve developed using serial dilutions of a commercially available DNA plasmid (OriGene) with complementary DNA sequences for human MT-ATP6.
-
bioRxiv - Immunology 2023Quote: A plasmid vector constitutively expressing the Rorc gene under the control of the CMV promoter (pCMV6-Rorc) (Origene, No. MR222309) was co-transfected with a plasmid expressing the luciferase gene (Luc ...
-
bioRxiv - Cell Biology 2024Quote: The generation of human cMPL receptor-expressing HEK293-A cells was achieved through a lipofectamine-mediated transfection of a plasmid expressing cMPL and GFP (Origene), previously linearized using the Scal restriction enzyme (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Microbiology 2020Quote: ... Stably transduced THF expressing human Flt-3R were generated by transduction with the lentivirus pLenti-FLT3-mGFP-P2A-Puro (OriGene Technologies RC211459L4V) followed by GFP purification after one week of Puro (800 μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+/AT1+ and HEK293/GC-A+/AT2+ cell lines were generated from HEK293/GC-A+ transfected with lentiviral particle with clones of either human AT1 or AT2 receptor (OriGene, Rockville, MD) using polybrene transfection agent ...
-
bioRxiv - Genomics 2023Quote: ... The oligoribonucleotides were incubated with either 10 µg HuR overexpressing HeLa cell whole cell extracts or 25-200 µM ELAVL1 human recombinant protein (Origene, Rockville, MD) in a 20 µL reaction mixture with 20 units of RNasin and 1X RNA binding buffer containing 20 mM HEPES (pH 7.6) ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Immunology 2022Quote: ... Cells (1 × 105) were mixed with 2 μg of 100 μg/ml of murine NEU3 expression plasmid (MR223297; Origene, Rockville, MD) in 100 μl PBS (GE Lifesciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293/GC-A+ and HEK293/GC-B+ cell lines were generated from HEK293 parental cell transfected with plasmids (OriGene, Rockville, MD) containing either human GC-A or GC-B cDNA sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... the lateral and contralateral tibialis anterior were injected with 30 µg of either control empty vector pCMV6 or Nr2f6-myc-flag overexpression plasmid (Origene, #MR206083) and 220V/cm were applied in 8 pulses of 20/200 ms on/off (ECM 830 Electroporator ...
-
bioRxiv - Molecular Biology 2022Quote: ... HC-04 cell line CYP 2D6 RNA levels were compared against commercially available human liver tissue CYP 2D6 RNA levels (OriGene Technologies, Rockville, MD). RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... constructs in the pGFP-V-RS vector and a non-targeting (NT: gcactaccagagctaactcagatagtact) pGFP-V-RS plasmid were purchased from OriGene (Cat. # TL515175). For lentivirus-mediated expression ...
-
bioRxiv - Cell Biology 2023Quote: ... The manufacturer’s protocol was used for viral production by mixing pLenti-C-TAZ-mGFP-P2A-Puro with packaging plasmids and transfection reagent from the Lenti-vpak packaging kit (OriGene, Cat#TR30037). The mixture was transfected into HEK293T cells to generate pseudoviral particles ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...