Labshake search
Citations for Origene Technologies :
201 - 250 of 594 citations for Human Immunodeficiency Virus P24 Protein HIV 1 Clade C since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Sections were blocked with protein block (OriGene) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number: RG227944). The primers used to clone the GFP fusion constructs for the other non-human species are shown in S9 Table ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses expressing pLenti-C-Myc-DDK-IRES-Neo (OriGene, empty vector) or vector with encoded WT CDKL5 (NM_001323289.2) ...
-
bioRxiv - Neuroscience 2022Quote: ... or pLenti-TDP-43ΔNLS/2KQL-C-mGFP (Origene, mutations by GenScript). Cells were seeded onto coverslips in 24-well plates at a density of 25,000 cells/well and incubated for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids pGFP-C-shLenti encoding shCYP27A1(TL313602) were from OriGene (OriGene Technologies GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... TRAF6 or MEKK3 proteins were purchased from Origene, as well as siRNA No Target ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Molecular Biology 2022Quote: HNRNPH1 full-length protein was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... and NICD: Mdm2 (MDM2 protein Gln119-Leu438 Origene TP761916 ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Genomics 2020Quote: Human full-length INTS6 ORF in pCMV6-entry vector was purchased from Origene (RC208036). The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and human STAS (NM_015012) were generated by PCR using plasmid templates obtained from OriGene and cloned downstream of the CMV enhancer and chicken beta-actin (CB ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA with complementary DNA sequences for human mtDNA was obtained from ORIGENE (SC101172). Concentrations were converted to copy number using the formula ...
-
bioRxiv - Cell Biology 2020Quote: ... and human pCMV6-KLHL41-Myc-DDK (RC200295) were purchased from Origene (Rockville, MD, USA). The control (D-01910-10-50) ...
-
bioRxiv - Cancer Biology 2019Quote: ... KDELR3 transcript variant 2 (NM_016657) Human Myc-DDK-tagged ORF Clone (Origene, CAT#: RC216726), KDELR3 transcript variant 1 (NM_006855 ...
-
bioRxiv - Cancer Biology 2019Quote: ... To knock down 4E-BP1 we used pGFP-V-RS EIF4EBP1 Human shRNA (OriGene) versus scramble and control vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cryopreserved normal human kidney and tonsil tissue blocks were purchased from Origene (Rockville, MD).
-
bioRxiv - Biochemistry 2021Quote: ... MICS1KD cells were generated using the human shRNA plasmid kit for MICS1 (Origene, TR315671B) with the shRNA construct #1 (GGTCTTGGAGCATTCTGCTACTATGGCTT ...
-
bioRxiv - Cell Biology 2022Quote: ... The human Hsp47 cDNA in pCMV6-XL5 plasmid was obtained from Origene (catalog#: SC119367). Scrambled siRNA GFP lentivector (catalog # ...
-
bioRxiv - Cell Biology 2023Quote: ... which were stably transfected with the human PML-VI gene (RC220236, OriGene, Rockville, MD), were selected using neomycin and were designated as HEKPML cells [34] ...
-
bioRxiv - Biochemistry 2023Quote: ... The wild-type human genes mS25 and bS16m were obtained in plasmids from OriGene. Mutations of cysteine/s in bS16m and mS25 coordinating Fe-S clusters to alanine ...
-
bioRxiv - Cell Biology 2023Quote: ... The following substrates were used in reactions: 0.15 µg of recombinant human Treacle (OriGene), and ~25 nM Pol I or Pol II isolated from S ...
-
bioRxiv - Biophysics 2024Quote: The commercial clone of full-length human hERG (NM_000238.3) cloned in pCMV6-XL4 (Origene) was subcloned in pmCherry-N1 (Clontech ...
-
bioRxiv - Cancer Biology 2019Quote: ... and siRNA C: SR422988C) or scrambled siRNAs (SR30004) were purchased from OriGene. Transfection was performed according to the vendor’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: pCMV6-c-MAF plasmid DNA was purchased from OriGene (Rockville, MD, USA). pCMV6-empty vector was used as a control ...
-
bioRxiv - Neuroscience 2023Quote: ... Lentivirus transduction for mGFP (pLenti-C-mGFP-P2A-Puro - Origene Cat# RC211875L4V), CLU_mGFP (CLU(mGFP-tagged)- human clusterin(CLU ...
-
bioRxiv - Cell Biology 2024Quote: ... mammalian vector with C-terminal Myc-DDK Tag (PS100001, Origene, Rockville, MD) as control were used ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were purchased commercially: NOTCH1 (Origene, Cat# TP762041), CDH6 (ACROBiosystem ...
-
bioRxiv - Cancer Biology 2019Quote: ... and PABP proteins were purchased from OriGene (Rockville, MD).
-
bioRxiv - Cell Biology 2019Quote: ... protein tag or peptide tag (Myc-DDK; OriGene Technologies). Images of the mCherry-tagged transfected cells were taken 24 hours posttransfection ...
-
bioRxiv - Genetics 2022Quote: ... Purified NAT2 protein was purchased from OriGene (CAT#: TP761755). 2-amino-3-methylimidazo [4,5-f] quinoline (IQ ...