Labshake search
Citations for Origene Technologies :
451 - 500 of 595 citations for Human IgG1 Anti Dengue Virus NS1 Serotype 1 Antibody OB4 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and unconjugated anti-GFP (Origene TA150070), anti-mCherry (Novus NBP2-25158) ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Immunology 2022Quote: ... 30 The anti-NEU3 (TA590228, Origene) was used at 0.5 µg/mL in PBS-BSA/500 mM NaCl/0.1% NP-40 alternative (EMD Millipore ...
-
bioRxiv - Genetics 2022Quote: ... and goat anti-KLF1 (Origene TA305808). The beads were retrieved using a magnetic stand and rinsed with RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... CDK2 mouse monoclonal antibody (HRP conjugated) [Clone ID: OTI2D9] (Origene, TA502935BM), monoclonal Anti-FLAG M2-peroxidase (HRP ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-ACAA2 (Origene Technologies, cat # TA506126). The slides were imaged using Nikon A1R laser scanning confocal microscope with Plan Apo 60x objective.
-
bioRxiv - Immunology 2023Quote: ... and goat anti-TdTomato (AB8181-200, Origene). The following secondary antibodies were all from Jackson ImmunoResearch unless noted ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-GFP (catalog#TA150041, OriGene, Rockville, MD) at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry (Origene, Cat. No.: AB0040-200), Anti-calnexin (Abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Microbiology 2020Quote: ... The slides were then incubated with an HRP-conjugated secondary antibody (OriGene) for 20 minutes at RT and stained with DAB (Vector Laboratories) ...
-
bioRxiv - Physiology 2022Quote: ... Flag immunoprecipitation was performed with antibody conjugated-magnetic beads (OriGene, Rockville, MD). The following antibodies were obtained for immunoblotting ...
-
bioRxiv - Biophysics 2021Quote: ... Other antibodies used in this study are commercially available as follows (TRIM69, Origene; Fancm ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: α-PRX3 (TA322472, rabbit; Origene, Rockville, USA), α-Mitofilin (ab48139 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were purchased against β-actin (Origene, Rockville, MD, USA, OG-TA811000), CRMP1 (ProSci ...
-
bioRxiv - Cancer Biology 2023Quote: ... under gentle agitation and incubated overnight with antibodies against Arc/Arg3.1 (TA349500, OriGene), CD9 (ab236630 ...
-
bioRxiv - Cancer Biology 2023Quote: The following antibodies were used for western blotting: PRR14L (Origene, Rockville, MD; TA331394), HA (Proteintech ...
-
bioRxiv - Cell Biology 2020Quote: ... the anti-TFAM (TA332462, rabbit; Origene, Rockville, USA) antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...
-
bioRxiv - Cell Biology 2021Quote: ... respectively): anti-SKAP (1ug/ml, rabbit, Origene, TA333584), anti-α-tubulin (DM1A ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were probed with primary antibodies against the N-terminal fragment of YFP (Origene), Flv2 and Flv3 (Antiprot) ...
-
bioRxiv - Cancer Biology 2024Quote: ... MA) and antibodies against tdTomato and Ki-67 were obtained from Origene (Rockville, MD) and Abcam (Boston ...
-
bioRxiv - Cell Biology 2024Quote: ... the following antibodies were used on paraffin sections: RFP (goat, Origene, cat# AB8181-200), RFP (rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP was detected using anti-GFP antisera (TP401, OriGene).
-
bioRxiv - Cell Biology 2022Quote: ... anti-desmoglein-2 mouse monoclonal (Origene, Rockville, MD, USA), anti-E-cadherin mouse monoclonal (BD ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-Myc-tag (9E10) was purchased from Origene; Rabbit anti-GM130 was purchased from Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-Lupus La #TA-00406 (Origene Technologies, Rockville, MD), anti-vinculin #ab129002 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... Mouse anti-Myc (9E10) Ab was from Origene (USA); Rabbit anti-GM130 was from Abcam (United Kingdom) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Znt3 mouse mAb (#TA501498, Origene Technologies, Rockville, MD), and anti-Znt4 rabbit pAb (#PA5-80028 ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse monoclonal anti-BAG5 (CF810618) was purchased from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-LGR5 mouse mAb (TA503316S, Origene, Rockville, MD, USA), anti- Keratin20 Rabbit mAb (#13063 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lgr5 (1:200) (Origene, TA503316), Oct4 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... GAPDH (Origene, TA802519, 1:5000), PCNA (BOSTER Biological Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tff1 (OriGene, TA322883 1:100), Tff2 (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:1000), Mpz (AvesLab ...
-
bioRxiv - Developmental Biology 2022Quote: ... K14 (OriGene, #BP5009, 1:1000), Involucrin (Biolegend ...
-
bioRxiv - Cell Biology 2020Quote: ... tdTomato (1:200, TA180009, OriGene), HuNu (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:200), Mpz (AvesLab ...