Labshake search
Citations for Origene Technologies :
401 - 450 of 460 citations for Human G Protein Coupled Receptor Family C Group 6 Member A GPRC6A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells with the respective plasmid and pLenti-C-mGFP-P2A-Puro Lentiviral Gene Expression Vector (Cat. #PS100093, Origene). Lipofectamine 2000 (Cat.# 11668030 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgin-45-HA-MAO was generated by >90% of the cell population was further confirmed through flow Gibson assembly using the HA-MAO vector digested with NheI/KpnI and golgin-45 cDNA (missing its C-ter, amino acids 1 to 368) purchased from Origene.
-
bioRxiv - Cancer Biology 2023Quote: ... The OC2 overexpression construct was generated by cloning the full-length OC2 cDNA (NM_004852) into the pLenti-C-Myc-DDK-IRES-Puro (Origene #PS10069) lenti-virus system ...
-
bioRxiv - Neuroscience 2024Quote: ... U251-MG cells were stably transfected with a GFP-tagged YTHDF2 expression plasmid pLenti-C-mGFP-P2A-Puro (OriGene, #RC230306L4) or GFP empty vector by lipofectamine 2000 according to the procedure recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... Louis, MO) (96, the C-terminal HA-tagged ERα was constructed from the purchased ERα cDNA expression clone (Origene #MG227304) into BamHI and EcoRI sites of pcDNA3 vector using PCR amplification ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Neuroscience 2022Quote: 1μL (1667fmol) 13C615N4-L-Arginine13C615N2-L-Lysine Stable Isotope Labeled (SIL) β4 protein standard (Origene #PH310440) was added to each sample (total=16 samples overall ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in TBS-T (1% Tween 20) with 5% BSA for 30 min and incubated with primary antibody against human ABCD1 (1:1,000; Origene, MD, US; Cat. No. TA803208) and β-actin (1:1,000 ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3×104 HT29 cells and 3×105 Caco2 cells were seeded in 6-wells plates and transduced with the Human Tagged ORF Clone lentiviral particles containing the pLenti-C-mGFP-P2A-Puro vector fused to the CaSR gene (RC211229L4V, OriGene, USA) (HT29CaSR-GFP and Caco2CaSR-GFP) ...
-
bioRxiv - Physiology 2021Quote: ... GGC CCG ATT GCT TCG AGA A (Nrf1) and pRFP-C-RS scrambled shRNA plasmid vectors were obtained from OriGene (TR30015). For analgesia ...
-
bioRxiv - Neuroscience 2022Quote: Stable knockdown of Cebpg in 50B11 cells was done by transfecting 50B11 cells with pGFP-C-shLenti carrying shRNA against Cebpg (1µg/ml; TL709448; Origene, Rockville, MD) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses were produced by transfecting HEK293T/17 cells with the pLenti-C-mGFP vector where SCXB has been inserted (OriGene, Rockville, MD) expressing Scx-GFP and two packaging plasmids33 (pCMV-dR8.2 ...
-
bioRxiv - Biochemistry 2020Quote: Viral vectors expressing lentiviral particles with 4 unique 29mer target-specific shRNA (A/B/C/D) to murine PRDX4 and 1 scramble control (non-specific or NS) were purchased from Origene (Rockville, MD). MIN6 cells were seeded on 48 well plates and cultured overnight in 0.3 mL medium ...
-
bioRxiv - Microbiology 2021Quote: ... A549-expressing human ACE2 (A549ACE2) cells were generated by transducing A549 cells with the ACE2-expressing lentiviral vector (pLenti-C-mGFP-ACE2) (Origene, Cat# PS100093) and then selected with puromycin according to the manufacturer’s procedure.
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Cell Biology 2023Quote: ... The OGT lentiviral vector was produced by first cloning OGT with C-terminal FLAG and HA tags into the pCMV6 entry vector (Origene, Rockville, MD) using the NEBuilder HiFi DNA assembly and Q5 site-directed mutagenesis kits according to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with 300 ng of each sgRNA-15xPBS plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin 8.0 (OriGene). Media was changed at 24 hours post-transfection.
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Pathology 2023Quote: Human astrocytes used co-culture were first transduced with lentiviruses carrying GFP (LentiORF control particles of pLenti-C-mGFP-P2A-Puro Origene™ cat# PS100093V), CLU (Lenti ORF particles ...
-
bioRxiv - Cancer Biology 2020Quote: In vitro immunoprecipitations were prepared using 0.012 μg of bacterially produced and purified recombinant RIOK2 protein (Origene, cat#TP602270) and 0.012 μg of bacterially produced and purified recombinant IMP3 protein (Origene ...
-
bioRxiv - Genomics 2021Quote: ... cells were transfected with 300 ng of each sgRNA plasmid and 40 ng of each fluorescent protein plasmid using 3.5 µL TurboFectin (OriGene). For competitor experiments ...
-
bioRxiv - Cancer Biology 2022Quote: The expression plasmids pCMV6-Entry-Empty and pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc were purchased from Origene (Tema Ricerca, Bologna, Italy). pGL3-NF-κb reporter ...
-
bioRxiv - Immunology 2023Quote: Bone marrow cells from the femurs of LB2 mice were isolated and transduced with either scrambled or Annexin A1 (Anxa1) shRNA using TR30030 pRFP-C-shLenti vector (Origene Technologies Inc. MD, USA) at an MOI of 150 ...
-
bioRxiv - Cell Biology 2022Quote: ... using Lenti-vpak Lentiviral Packaging Kit (Origene Technologies, Inc.). The HEK 293T cells were expanded in DMEM (high glucose ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Cancer Biology 2021Quote: ... monitoring of interactions of PRKAR1a or GSK3b with HK2 was carried out in coating buffer and increasing concentration of Myc-HK2 protein (OriGene; 0-64nM ...
-
bioRxiv - Pathology 2021Quote: ... Additional positive and negative control experiments were performed in which purified recombinant PBX1 and MEIS2 proteins (purchased from Origene, Rockville, MD) were incubated with the same concentrations of each drug and assayed.
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pCMV6-AC-GFP-rtTA-APE1 (for WT tGFP-APE1 protein) was prepared by PCR full-length APE1 from pET28HIS-hAPE1 and subcloned into pCMV6-AC-GFP-rtTA vector (Origene #PS100125) at AscI and RsrII sites ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR/Cas9 knockout (KO) kit was purchased from Origene (KN206895) and cell lines were generated following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2 ...
-
bioRxiv - Cancer Biology 2019Quote: Recombinant Myc-Flag-RNF114 proteins were either purified from HEK292T cells as described above or purchased from Origene (Origene Technologies Inc., TP309752). For in vitro auto-ubiquitination assay ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized using the first-strand cDNA synthesis kit (Origene) with 1 μg of total RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... reverse transcription was performed with First-strand cDNA Synthesis kit (OriGene). For RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... The lentivirus contained the human ACE2 gene under control of the CMV promoter along with green fluorescent protein (GFP) also under control of a separate CMV promoter (Origene Technologies, Rockville, MD). A MOI of 20 was used for lentivirus transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... The peroxidase reaction was developed with DAB kit (ZLI-9019, ORIGENE, Beijing, CHN) and the slides were counterstained with hematoxylin ...
-
bioRxiv - Cell Biology 2021Quote: ... and purified using PowerPrep HP Plasmid Maxiprep kits with prefilters (Origene, Rockville, MD). The SH-SY5Y neuroblastoma cells were transfected with 10 ug of plasmid DNAs when 60% confluence in 100-mm dishes using transfection reagents GenJet II (SignaGen Laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... Extracted RNA was converted to cDNA using the First Strand cDNA Synthesis kit (Origene) and then subjected to real time quantitative PCR using SYBR Green Master mix (BioRad ...