Labshake search
Citations for Origene Technologies :
201 - 250 of 650 citations for Human Fibrinogen C Domain Containing Protein 1 FIBCD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... with the full-length c DNA for CCL2 (OriGene). AAV serotype 5 (AAV5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfer plasmid containing the A20 insert was obtained from Origene (MR210582L4 ...
-
bioRxiv - Cell Biology 2020Quote: ... pCMV6-XL4-PPARγ (human sequence) was purchased from Origene (Rockville, MD, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... Human cDNA encoding FBOX genes were procured from Origene (Rockville, MA, USA). mVenusC1 was gifted by Dr ...
-
bioRxiv - Biochemistry 2020Quote: The human cDNA clones of LRPPRC and SLIRP were provided by OriGene (product numbers ...
-
bioRxiv - Molecular Biology 2022Quote: ... GTPBP3 (NM_001128855) Human Tagged ORF Clone was purchased from Origene (cat # RC225798).
-
bioRxiv - Cell Biology 2021Quote: ... prosaposin was amplified from human prosaposin cDNA (pCMV6-XL5-PSAP, Origene, # SC118405), SBP-mCherry and the Str-KDEL_SBP-mCherry-GPI (Addgene # 65295 ...
-
bioRxiv - Biophysics 2022Quote: Human LRRC8A and LRRC8C cDNAs cloned into pCMV6 were purchased from OriGene Technologies ...
-
Mitochondrial ROS1 increases mitochondrial fission and respiration in oral squamous cancer carcinomabioRxiv - Cancer Biology 2020Quote: The plasmid encoding human ROS1 (ROS1-myc, #RC220652) was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfected plasmids were human MNT (pCMVSport6-MNT, Origene Technologies, Rockville, MD, USA); ΔbHLH MNT-HA (murine MNT carrying a deletion of amino acids 221-272 amino acids and tagged with HA ...
-
bioRxiv - Molecular Biology 2022Quote: 2.5ug Nudt6 Human Tagged ORF Clone (OriGene Technologies, Inc. Rockville, MD, USA) or GFP plasmid respectively were digested with XhoI for 1hr (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: We used a pCMV-human TFEB expressing vector from Origene (clone # sc122773), used previously 27 ...
-
bioRxiv - Neuroscience 2023Quote: The following plasmids have been used in the manuscript: human SATB1 (Origene), human GBA (Origene) ...
-
bioRxiv - Physiology 2023Quote: ... For human leptin ORF clone (Origene; pCMV-leptin-DDK-Myc; CAT#: RC209259) was used for mutagenizing the AIM sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... two different anti-human DSG2 antibodies (DSG2-Origene, #BM5016; DSG2-Abcam, #ab14415) were used at 1:1000 dilutions in blocking buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transfected with Twist (TWIST1) (NM_000474) Human Tagged ORF Clone (Origene). Transfected cells underwent 3 weeks selection procedure with Neomycin (400 µg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... a combination of four unique 29mer pRFP-C-RS-FHDC1 short hairpin RNA (shRNA) constructs (TF705017A, B, C, D, OriGene Technologies Inc, Rockville, MD) was introduced into the cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the C-terminal of wild type SOX9 (RC208944, Origene) using SgfI and MluI restriction sites ...
-
bioRxiv - Genomics 2023Quote: c-myc-tagged Ephb4 cDNA in pCMV6 was from Origene. Single K650N ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein DHX36 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were blocked with protein block (OriGene) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... virus-containing supernatant was collected and concentrated using Lenti-Concentrator (OriGene), for minimum 2h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... We cloned SMPD3 (SMPD3 Human Tagged ORF Clone, Origene Cat#: RG218441, RefSeq-NM_018667.2) and ...
-
bioRxiv - Physiology 2020Quote: ... injected with the same dose of recombinant human NTF3 (OriGene Technologies, Rockville, MD) every day for the first two weeks ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: KDM6A targeting human shRNA expressing plasmids were purchased from OriGene (TL300596C and TL300596D). KDM6B targeting human shRNA plasmid was purchased from Sigma (TRCN0000236677) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The human SLC22A24 GFP fusion construct was purchased from OriGene (Catalog number: RG227944). The primers used to clone the GFP fusion constructs for the other non-human species are shown in S9 Table ...
-
bioRxiv - Cancer Biology 2019Quote: Human gp78/AMFR expression vector was cloned using AMFR (NM_001144) sequence (RG209639, Origene) into pDest-653 destination vector by the Protein Expression Laboratory ...
-
bioRxiv - Immunology 2020Quote: Human STING and SURF4 were subcloned from HEK293T cDNA into pCMV6-AC (Origene) with a FLAG tag at the C-terminus or a HA tag at the N-terminus ...
-
bioRxiv - Immunology 2020Quote: ... and turboGFP (tGFP)-tagged human CAPRI and control tGFP alone were from OriGene Inc ...
-
bioRxiv - Immunology 2020Quote: ... The human MSR1 (Cat# RC209609) were obtained from Origene (Rockville, MD 20850, USA). Human MSR1 and its fragment 1-50 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with a vector expressing GFP-tagged human FXR (NM_001206979, OriGene) by using X-tremeGENE HP DNA Transfection Reagent (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... berghei (Pb-M1; Pb-M17) and three human M1 homologues: LTA4H (OriGene TP307617), ERAP1 (OriGene TP314469 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid encoding human DGKε (hDGKε, NM_003647) was purchased from OriGene (cat. No. RC219913). The DGKE coding sequence was subcloned into the pcDNA3.1/Hygro(+)-2xMyc vector using primers ...
-
bioRxiv - Biochemistry 2023Quote: ... or 10 μg human ACSS2-overexpressing HEK-293 cell lysate (ref. LY412981, Origene, MD ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses expressing pLenti-C-Myc-DDK-IRES-Neo (OriGene, empty vector) or vector with encoded WT CDKL5 (NM_001323289.2) ...
-
bioRxiv - Neuroscience 2022Quote: ... or pLenti-TDP-43ΔNLS/2KQL-C-mGFP (Origene, mutations by GenScript). Cells were seeded onto coverslips in 24-well plates at a density of 25,000 cells/well and incubated for 24 h ...
-
bioRxiv - Biochemistry 2023Quote: The plasmids pGFP-C-shLenti encoding shCYP27A1(TL313602) were from OriGene (OriGene Technologies GmbH ...
-
bioRxiv - Microbiology 2020Quote: ... TRAF6 or MEKK3 proteins were purchased from Origene, as well as siRNA No Target ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Molecular Biology 2022Quote: HNRNPH1 full-length protein was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Cell Biology 2023Quote: ... and NICD: Mdm2 (MDM2 protein Gln119-Leu438 Origene TP761916 ...
-
bioRxiv - Cell Biology 2021Quote: ... or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208) for 18hrs at 37° ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...