Labshake search
Citations for Origene Technologies :
51 - 100 of 309 citations for Human DAG Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 CIC OE cells were developed using CIC-Myc-tag plasmid purchased from Origene (CAT#: RC215209). Geneticin (250μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse YAP1 WT gene with a Myc-tag in the pCMV6 backbone was purchased from Origene (MR226049). YAP S274A and YAP S352A mutants were generated by PCR assembly ...
-
bioRxiv - Biophysics 2023Quote: HEK cells were transfected with plasmid encoding the +SS4 isoform of N1β with a C-terminal tGFP tag (Origene) (HEK-N1β ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
-
bioRxiv - Neuroscience 2020Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Cancer Biology 2020Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... whereas the ORF encoding human p130 from Origene.
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Genomics 2022Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Cancer Biology 2019Quote: ... we purchased wild-type mammalian expression plasmids with C-terminal FLAG tag were purchased from Origene (Origene Technologies Inc., RC209752). The RNF114 C8A mutant was generated with Q5 site-directed mutagenesis kit according to manufacturer’s instructions (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-2272) were expressed with a C-terminal Myc-DDK (FLAG) tag from a pCMV6-Entry backbone (#RC218208, Origene, USA) in Expi 293F suspension cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid containing source cDNA sequence for Mus musculus MIM (NM_144800) with C-terminal myc- and FLAG-tag was purchased from Origene (MR210506). All plasmids were sequenced to confirm the correct coding sequence (Eton Bioscience).
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2022Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
-
bioRxiv - Biophysics 2019Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
-
bioRxiv - Molecular Biology 2020Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
-
bioRxiv - Neuroscience 2022Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
-
bioRxiv - Cancer Biology 2021Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... C-kit Variant 2 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Immunology 2020Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
-
bioRxiv - Neuroscience 2023Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
-
bioRxiv - Biophysics 2023Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
-
bioRxiv - Physiology 2021Quote: ... the pRL-TK renilla luciferase vector as an internal control and varying concentration of a CASR containing a myc tag vector (Origene Inc.). After 24 hr incubation with standard medium containing 1.5 mM calcium the cells were assayed for Cldn14 reporter expression using a luciferase assay system from Pormega Corp ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Cell Biology 2022Quote: ... we subcloned their ORFs into pCMV6 vector with HA or DDK tag directly from a commercially purchased pCMV6-GFP and pCMV6-HA expression clones (Origene Technologies), respectively ...