Labshake search

51 - 100 of 299 citations for Human Brain Derived Neurotrophic Factor BDNF ELISA Kit since 2019

• CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesis

  Stéphane M. Camus, et al., bioRxiv - Cell Biology 2019

  Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...
• Cell adhesion molecule interaction with Piezo1 channels is a mechanism for sub cellular regulation of mechanical sensitivity

  E Chuntharpursat-Bon, et al., bioRxiv - Cell Biology 2019

  Quote: ... Human CD31 was obtained from Origene (TrueClone, SC119894). Piezo1 and CD31 pcDNA6 templates were generated by inverse PCR with the Phusion® DNA polymerase (New England Bio Labs) ...
• Harnessing the Anti-Cancer Natural Product Nimbolide for Targeted Protein Degradation

  Jessica N. Spradlin, et al., bioRxiv - Cancer Biology 2019

  Quote: ... Recombinant pure human proteins were purchased from Origene. Pure proteins (0.1 μg ...
• SETD2 is an actin lysine methyltransferase

  Riyad N.H. Seervai, et al., bioRxiv - Cell Biology 2020

  Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
• SETD2 is an actin lysine methyltransferase

  Riyad N.H. Seervai, et al., bioRxiv - Cell Biology 2020

  Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
• Impaired α-tubulin re-tyrosination leads to synaptic dysfunction and is a feature of Alzheimer’s disease

  Leticia Peris, et al., bioRxiv - Neuroscience 2021

  Quote: ... and cDNA encoding human TTL (NP_714923, Origene #RC207805L2) was cloned in it for TTL expression ...
• RIOK2 drives glioblastoma cell proliferation by modulating MYC through the RNA-binding protein IMP3

  Alexander S. Chen, et al., bioRxiv - Cancer Biology 2020

  Quote: ... Human RIOK2-flag cDNAs encoding isoform I (Origene) were cloned into pRev-Tre tetracycline inducible vectors (Clontech) ...
• GAPDH controls extracellular vesicle biogenesis and enhances therapeutic potential of EVs in silencing the Huntingtin gene in mice via siRNA delivery

  Ghulam Hassan Dar, et al., bioRxiv - Neuroscience 2020

  Quote: The cDNA sequence of human GAPDH (OriGene, UK) was inserted into the pET-28b(+ ...
• Differential Mast Cell Phenotypes in Benign versus Cancer Tissues and Prostate Cancer Oncologic Outcomes

  Heidi Hempel Sullivan, et al., bioRxiv - Cancer Biology 2020

  Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...
• Targeting Vitamin-D receptor (VDR) by a small molecule antagonist MeTC7 inhibits PD-L1 but controls THMYCN neuroblastoma growth PD-L1 independently

  Rakesh K. Singh, et al., bioRxiv - Cancer Biology 2020

  Quote: ... human VDR transcript variant 2 cDNA (OriGene, RC519628) was transfected into the SKOV3 cells using Lipofectamine 2000TM (Invitrogen ...
• The E2F4/p130 repressor complex cooperates with oncogenic ΔNp73α to promote cell survival in human papillomavirus 38 E6/E7-transformed keratinocytes and in cancer cells

  Valerio Taverniti, et al., bioRxiv - Cancer Biology 2022

  Quote: ... whereas the ORF encoding human p130 from Origene.
• MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browning

  Qinhao Wang, et al., bioRxiv - Cancer Biology 2023

  Quote: ... Human CD36 or control shRNA constructs (Origene, TR314090) were transfected into parental HCT116 cells using Lipofectamine 2000 (Invitrogen ...
• Moonlighting on the Fasciola hepatica tegument: enolase, a glycolytic enzyme, interacts with the extracellular matrix and fibrinolytic system of the host

  Eve O’Kelly, et al., bioRxiv - Molecular Biology 2024

  Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
• ADGRG6 promotes adipogenesis and is involved in sex-specific fat distribution

  Hai P. Nguyen, et al., bioRxiv - Genomics 2022

  Quote: ... sub-confluent human preadipocytes were transfected with 500ng ADGRG6 expression plasmid Myc-DDK-tagged human G protein-coupled receptor 126 (Origene, RC212889) using LipoMag transfection reagent and cells were then subjected to the adipocyte differentiation protocol described above.
• Nucleoporin 153 links nuclear pore complex to chromatin architecture by mediating CTCF and cohesin binding at cis-regulatory elements and TAD boundaries

  Shinichi Kadota, et al., bioRxiv - Cell Biology 2020

  Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
• UBA52 attunes VDAC1-mediated mitochondrial dysfunction and dopaminergic neuronal death

  Shubhangini Tiwari, et al., bioRxiv - Neuroscience 2022

  Quote: Plasmid constructs overexpressing Myc-ddk tagged wild-type human α-syn (Myc-α-synuclein) and Myc-ddk tagged wild-type human UBA52 (Myc-UBA52) were purchased from Origene technologies ...
• ER membranes exhibit phase behavior at sites of organelle contact

  Christopher King, et al., bioRxiv - Biophysics 2019

  Quote: ... Human mitofusin 1-GFP was purchased from OriGene (#RG207184).
• Distinct and sequential re-replication barriers ensure precise genome duplication

  Yizhuo Zhou, et al., bioRxiv - Molecular Biology 2020

  Quote: 200 ng of recombinant human Cdt1 (OriGene, Cat #: TP301657) and 20 ng of purified Cyclin A/Cdk1 (Sigma cat ...
• GSAP Regulates Amyloid Beta Production through Modulation of Amyloid Precursor Protein Trafficking

  Jerry C. Chang, et al., bioRxiv - Neuroscience 2020

  Quote: ... human Arcn1 with Myc and Flag tags (RC210778, Origene), Flag-APP-C99 was a kind gift from Wenjie Luo (Weill Cornell Medical College) ...
• Membrane-associated shortened Trk receptors promote neuroprotection and robust axon regeneration without ligands

  Euido Nishijima, et al., bioRxiv - Neuroscience 2022

  Quote: A plasmid encoding human TrkB was purchased from OriGene Technologies ...
• Intra-membrane client recognition potentiates the chaperone functions of Calnexin

  Nicolas Bloemeke, et al., bioRxiv - Cell Biology 2022

  Quote: ... Human Cx32 and Rhodopsin cDNA was obtained from Origene and cloned into a pSVL vector (Amersham) ...
• SIRT5 is the desuccinylase of LDHA as novel cancer metastatic stimulator in aggressive prostate cancer

  Oh Kwang Kwon, et al., bioRxiv - Cancer Biology 2021

  Quote: Human LDHA plasmid was purchased from Origene (MD, USA). Succinylation mutants of LDHA were generated using site-directed mutagenesis kit (GeneAll ...
• A conserved SUMO-Ubiquitin pathway directed by RNF4/SLX5-SLX8 and PIAS4/SIZ1 drives proteasomal degradation of topoisomerase DNA-protein crosslinks

  Yilun Sun, et al., bioRxiv - Molecular Biology 2019

  Quote: ... Recombinant human PIAS4 was purchased from OriGene (Cat. # TP306748). Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat ...
• Opposing activities of IFITM proteins in SARS-CoV-2 infection

  Guoli Shi, et al., bioRxiv - Immunology 2020

  Quote: ... HEK293T cells stably expressing GFP-tagged human ACE2 (Origene) were generated using the same methodology ...
• The adhesion GPCR Adgrd1 is a prion protein receptor and a mediator of prion cytotoxicity

  Asvin KK Lakkaraju, et al., bioRxiv - Neuroscience 2023

  Quote: ... Human Adgrd1 cDNA was obtained from Origene (Cat: PS100001). Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs ...
• An optogenetic method for the controlled release of single molecules

  Purba Kashyap, et al., bioRxiv - Biophysics 2023

  Quote: ... the cDNA encoding for human TMEM115 (Origene cat# RG203956) was cloned into pEGFP-C1 using NheI and BsrGI restriction sites ...
• Angiogenin regulates mitochondrial stress and function via tRNA-derived fragments generation and impacting tRNA modifications

  Shadi Al-Mesitef, et al., bioRxiv - Molecular Biology 2024

  Quote: ... FLAG-tagged human angiogenin plasmid (hANG) (OriGene, Cat# RC208874) and Mock plasmid were transiently transfected according to the manufacturer’s protocol into HEK293T cells in full growth medium using Lipofectamine 3000 (Thermo Fisher Scientific ...
• HLJ1 amplifies endotoxin–induced sepsis severity by promoting IL-12 heterodimerization in macrophages

  Wei-Jia Luo, et al., bioRxiv - Immunology 2022

  Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
• The cell and stress-specific canonical and non-canonical tRNA cleavage

  Sherif Rashad, Teiji Tominaga, Kuniyasu Niizuma, bioRxiv - Molecular Biology 2020

  Quote: ... FLAG-tagged human angiogenin plasmid (Cat# RC208874; OriGene; Rockville, MD), GFP-tagged rat RNH1 plasmid (Cat# ORa42809C ...
• Rabaptin5 targets autophagy to damaged endosomes and SCVs by interaction with FIP200 and ATG16L1

  Valentina Millarte, et al., bioRxiv - Cell Biology 2021

  Quote: ... The cDNA of human FIP200 was purchased from OriGene (SC114884), pmCherry_Gal3 was a gift from Hemmo Meyer (Addgene plasmid #85662 ...
• Inherited duplications of PPP2R3B promote naevi and melanoma via a novel C21orf91-driven proliferative phenotype

  Satyamaanasa Polubothu, et al., bioRxiv - Genomics 2019

  Quote: Human myc-FLAG tagged PPP2R3B ORF clone from Origene (RC222908) was linearised and the insert DNA amplified using modified primers generating an N-terminal Myc tag ...
• The late endosome-resident lipid bis(monoacylglycero)phosphate is a cofactor for Lassa virus fusion

  Ruben M. Markosyan, et al., bioRxiv - Microbiology 2021

  Quote: ... A soluble fragment of human LAMP1 was obtained from Origene Protein (Cat# TP720784) ...
• Estradiol (E2) concentration shapes the chromatin binding landscape of the estrogen receptor

  Amy L. Han, et al., bioRxiv - Molecular Biology 2022

  Quote: STAT1 human siRNA Oligo Duplex and nontargeting scramble siRNA (Origene) were transiently transfected in the MCF7 cells ...
• A non-ligand surrogate agonist antibody that enhances canonical Wnt signaling and bone regeneration

  Nam-Kyung Lee, et al., bioRxiv - Bioengineering 2022

  Quote: Full-length human LRP6 was cloned into pCMV-Entry (Origene) and used for sub-cloning ...
• Inhibiting a mRNA motif binding protein that mediates TGF-β1 upregulation of translation attenuates pulmonary fibrosis in mice

  Wensheng Chen, Darrell Pilling, Richard H. Gomer, bioRxiv - Immunology 2022

  Quote: The human Myc-NEU3 expression plasmid RC216537 (Origene, Rockville, MD) was used to express NEU3 ...
• Schlafen14 Regulates Gene Expression Depending on Codon Usage

  Carlos Valenzuela, Sergio Saucedo, Manuel Llano, bioRxiv - Molecular Biology 2023

  Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
• Adopting orphan receptors: group IX/X transition metals as potential ligands of zebrafish Tlr4 homologs

  Aaron P.D. Fox, et al., bioRxiv - Zoology 2023

  Quote: ... an empty vector or human MD-2 (OriGene, cat. #RC204686) were transiently expressed ...
• Reduced S-nitrosylation of TGFβ1 elevates its binding affinity towards the receptor and promotes fibrogenic signaling in the breast

  Joshua Letson, Saori Furuta, bioRxiv - Cancer Biology 2023

  Quote: ... The TGF beta 1 (NM_000660) Human Untagged Clone (Origene, SC119746) was used to perform site-directed mutagenesis on residues C355 ...
• Tmem263 deletion disrupts the GH/IGF-1 axis and causes dwarfism and impairs skeletal acquisition

  Dylan C. Sarver, et al., bioRxiv - Physiology 2023

  Quote: ... Rabbit polyclonal anti-human C12orf23 (TMEM263) was from Origene (TA333490). Mouse monoclonal JAK2 (C-10) ...
• Mutations in TMEM43 cause autosomal dominant auditory neuropathy spectrum disorder via interaction with connexin-mediated passive conductance channels

  Minwoo Wendy Jang, et al., bioRxiv - Genetics 2020

  Quote: ... GJB2 (NM_004004) Human Tagged ORF Clone was purchased from OriGene (RC202092) and Cx30-msfGFP was purchased from Addgene (69019).
• Using Extracellular Vesicles Released by GDNF-transfected Macrophages for Therapy of Parkinson’s Disease

  Yuling Zhao, et al., bioRxiv - Bioengineering 2022

  Quote: Human GDNF cDNA (NM_199234) was provided by OriGene (Rockville, MD, USA) that was propagated in DH5α E.coli ...
• Evidence for the digital programming of cellular differentiation: characterization of binary switches in lineage-determining transcription factors

  Hongchuan Li, et al., bioRxiv - Developmental Biology 2022

  Quote: A panel of 20 normal human tissues was purchased from OriGene Technologies (Rockville ...
• Aquaporin-3 regulates endosome-to-cytosol transfer via lipid peroxidation for cross presentation

  Sam C. Nalle, et al., bioRxiv - Immunology 2020

  Quote: ... The human pCMV6-AC-AQP9-GFP expression vector was from Origene. 30% H2O2 solution ...
• YAP antagonizes TEAD-mediated AR signaling and prostate cancer growth

  Shu Zhuo, et al., bioRxiv - Cancer Biology 2022

  Quote: ... The human TEAD4 constructs were purchased from Origene (https://www.origene.com/; RC219686). TEAD4 full length and deletion constructs were amplified by PCR and the PCR products were sub-cloned in to a pcDNA3.1-FLAG vector ...
• Multi-level monitoring of EME1-MUS81 in CPT induced nucleolar rDNA repair

  Karishma Bakshi, et al., bioRxiv - Molecular Biology 2022

  Quote: Human siRNAs for the knock down assays were ordered from OriGene (IPO7 ...
• A furin-deficient HEK293 cell line suggests a role for furin trafficking in the intoxication pathway of recombinant immunotoxins based on Pseudomonas exotoxin A

  Brian D. Grossman, et al., bioRxiv - Molecular Biology 2023

  Quote: ... Human furin cDNA (product #RC204279) was obtained from OriGene (Rockville, MD) and inserted into the pcDNA5/FRT plasmid for stable transfection into HEK293 FRT cells ...
• Regulation of VEGFR2 and AKT signaling by Musashi-2 in lung cancer

  Igor Bychkov, et al., bioRxiv - Cell Biology 2023

  Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
• A gene silencing pipeline to interrogate human cDC1 and pDC development and functions

  Xinlong Luo, et al., bioRxiv - Immunology 2023

  Quote: ... CDS of IRF8 from IRF8 human tagged ORF clone (RG217646, Origene) were cloned and digested with BamHD1 and XhoI ...
• Impaired AMPK activity contributes to the inflammatory phenotype and the reduced phagocytosis capacity of VASP-deficient macrophages

  Hebatullah Laban, et al., bioRxiv - Cell Biology 2023

  Quote: ... HEK cells were co-transfected with human flag-tagged PP1R6 (Origene) and His6-tagged VASP (Benz et al. ...
• CYP4F2 is a human-specific determinant of circulating N-acyl amino acid levels

  Julia T. Tanzo, et al., bioRxiv - Biochemistry 2023

  Quote: ... PCR was performed using the human CYP4F2-myc-DDK (OriGene RC216427) plasmid (Forward primer ...