Labshake search
Citations for Origene Technologies :
1 - 50 of 414 citations for FGF 8B Human Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... or FLAG-mNUP153 (mouse) expression vectors were constructed by amplifying full length human NUP153 or mouse NUP153 cDNA using human NUP153 cDNA (Origene, SC116943) or mouse NUP143 cDNA (ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human and mouse SLFN14 (Origene, RC226257 and MR225976) were expressed from pCMV6-Entry ...
-
bioRxiv - Molecular Biology 2023Quote: ... Constructs including human (NM_005987) and mouse Sprr1a (NM_009264) were purchased from Origene, bearing the pCMV6 vector backbone with C-terminal Myc-DDK Tag ...
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human PD-L1 (primary antibody, CD273, Clone OTI9E12, ORIGENE, MD, USA) and APC goat anti-mouse IgG (secondary antibody ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary monoclonal antibodies included mouse anti-human ACE2 (1:1500) (Origene, Rockland, Maryland), rabbit anti-human (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs constructs targeting human or mouse ATRX were obtained from OriGene (Rockville, MD, USA). The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A ...
-
bioRxiv - Microbiology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA); the goat anti-mouse MSR1 (Cat# AF1797) ...
-
bioRxiv - Immunology 2020Quote: ... The mouse anti-FLAG (Cat# TA50011) and rabbit anti-human/mouse MSR1 (Cat# TA336699) antibodies were from Origene (Rockville, MD 20850, USA). The mouse anti-human MSR1 (Cat# MAB2708 ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-tagged human sclerostin (#RG217648)- and myc-tagged mouse sclerostin (#MR222588) were purchased from Origene. KillerRed plasmid (FP966 ...
-
bioRxiv - Genetics 2020Quote: ... slices were incubated with mouse antibody against human TP53 (1:150) (ZSGB-BIO ORIGENE, Beijing, China) at 4°C followed by secondary antibody (Dako Cytomation ...
-
bioRxiv - Physiology 2021Quote: ... Full-length human (RC211179) and mouse GCGR (MR207767) both Myc-DDK-tagged cDNA were obtained from OriGene Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... For chaperone over-expression: either human PDEδ (NM_002601.4; Dharmacon MHS6278-202829730) or mouse UNC119A (NM_005148; Origene RC203758) was cloned in front of a T2A site followed by mCherry to allow for co-translational cleavage and expression ...
-
bioRxiv - Neuroscience 2020Quote: Stable cell lines were generated in HEK293 (ATCC, mycoplasma free) using a pCMV vector expressing either 1µg of mouse or human TRPC5 (Origene) co-transfected with 7µg of pBabe Puro vector for rapid stable selection ...
-
bioRxiv - Cell Biology 2023Quote: ... PRB-114P) was from Covance. Mouse monoclonal anti-human JC (clone 3C7, aka OTI3C7) (cat. TA504168) was obtained from OriGene Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Human cDNA (Origene) of NgR1 (NM_023004) ...
-
bioRxiv - Neuroscience 2023Quote: ... human GBA (Origene), human a-SYN (A53T mutant ...
-
bioRxiv - Immunology 2021Quote: ... The Emory University Integrated Genomics core facility (Atlanta, GA) subcloned mouse and human Esm-1 cDNA from pCMV6 (Origene, Rockville, MD) into pT3 ...
-
bioRxiv - Immunology 2023Quote: Tissue paraffin sections were stained with H&E for histopathological evaluation or with biotinylated anti-mouse-IgG (Vector; BA-9200) for the detection of immune complex deposits and anti-human IL23A (OriGene; AM20386PU-N) for the detection of human IL23A protein in various tissues.
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Microbiology 2022Quote: Human CD164 (Origene, #RC202234) and mouse Cd164 (Origene ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 human plasmid (Origene) was transfected using X-tremeGENE HP Transfection Reagent (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Physiology 2023Quote: Human AgRP (Origene CAT#: RC217144) was cloned into CAG-NLS-GFP (Addgene# ...
-
bioRxiv - Cell Biology 2023Quote: ... human FBXO38 cDNA (Origene #RC204380) was cloned into pcDNA3.1 containing N-terminal twinStrepII- FLAG-tag (NSF) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human SNAP43 (SNAPC1) (Origene, TP760339), Human MBP (gift of A ...
-
bioRxiv - Neuroscience 2023Quote: ... or human ELP1 (Origene RC2076868), ELP1 (NM_003640) ...
-
bioRxiv - Cancer Biology 2023Quote: Myc-Flag-human TEADs (OriGene) and V5-ubiquitin (generated in house ...
-
bioRxiv - Cancer Biology 2023Quote: Human SFRP1 (Origene plasmid #RC207328) or Notum (Gateway ORF clone ID #164485821 ...
-
bioRxiv - Biochemistry 2020Quote: ... human FGF1-myc-DDK (Origene RC207434), human flag-FGF2 (SinoBiological HG10014-NF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... CXCR4 human ORF cDNA clone (Origene, Rockville ...
-
bioRxiv - Biochemistry 2022Quote: ... human testis FFPE tissue (Origene, CB811079) was first sliced ...
-
bioRxiv - Cell Biology 2021Quote: ... or human GPR87 ORF (Origene, RC218486L3)) for 6 hrs ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human IL-1β (Origene #RC202079L4) plasmid constructs were used for generating stable LNCaP cells ...
-
bioRxiv - Cancer Biology 2020Quote: DUSP1 human overexpression plasmid (Origene, NM_004417) was expanded and transfected into 451Lu BRAFi-R and 1205Lu BRAFi-R cells using jetPRIME® transfection reagent (Polyplus transfection) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human MTERF (MTERF1) (Origene, TP761846). Proteins injected were serially diluted (two-fold each step ...
-
bioRxiv - Neuroscience 2023Quote: The human GPR37L1 cDNA clone (Origene) was subcloned into pcDNA3.1+ (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: Human CYP4F2-myc-DDK (OriGene RC216427), human
-
bioRxiv - Physiology 2023Quote: Human SLC8B1 cDNA (Origene #RC214624; NM_024959) was PCR amplified using primers to introduce a 5′ AgeI restriction site and a 3′ BamHI restriction site flanking the coding sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Human Dlk2 pCMV6 (RC210622, Origene) vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified human recombinant NRXN3 TP323448 (Origene) was used as standard ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human p97/VCP (NM_007126, SC125280), human UFD1L (NM_005659, SC320168), and human NPLOC4 (NM_017921, SC113845) expression plasmids were purchased from OriGene.
-
bioRxiv - Neuroscience 2024Quote: ... we cloned human IgLON5 deletion constructs from full-length Myc-DKK-tagged human IgLON5 plasmid (Origene, #225495) using a Q5® Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Plaat cDNAs were purchased from ORIGENE [RC208444 for PLAAT1 (NM_020386) ...
-
bioRxiv - Neuroscience 2021Quote: Human cDNA panels were obtained from Origene: TissueScan ...
-
bioRxiv - Biochemistry 2021Quote: ... Human ERβ cDNA was obtained from OriGene Technologies (Rockville ...
-
bioRxiv - Biochemistry 2023Quote: ... and human CYB5R1-myc-DDK (OriGene RC205833L3) plasmids were transiently co-transfected into HEK293T cells using PolyFect (Qiagen 301105 ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The plasmid encoding human GLUT1 was from OriGene. The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1 ...