Labshake search
Citations for Origene Technologies :
1 - 50 of 196 citations for F actin uncapping protein LRRC16A CARMIL1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP720518).
-
bioRxiv - Cell Biology 2020Quote: ... beta actin (NM_001101) human recombinant protein (Origene, TP303643), beta actin (NM_001101 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies were purchased against β-actin (Origene, Rockville, MD, USA, OG-TA811000), CRMP1 (ProSci ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
bioRxiv - Molecular Biology 2024Quote: ... OGDH F: GGTGTCGTCAATCAGCCTGAGT R: ATCCAGCCAGTGCTTGATGTGC (Origene, UK); PGC1α F ...
-
bioRxiv - Genetics 2021Quote: ... β-actin (ZSGB-Bio ORIGENE, Beijing, China); goat antimouse secondary antibody and goat antirabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Intracellular staining of influenza A nucleoprotein was done by applying the anti influenza A (nucleoprotein) – FITC antibody (OriGene, AM00924FC-N) for 60 min at 4 °C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... TCR-T cells were tested for activation-induced cytolytic responses by coincubation with target cells (1:1) overnight followed by staining with anti-murine TCR constant domain antibody (FITC, CL075F, Origene) and anti-CD107a mAb (PE-Cy5 ...
-
bioRxiv - Pathology 2023Quote: ... and β-actin (1:2000, Origene, TA811000S) was used as loading control ...
-
bioRxiv - Neuroscience 2022Quote: ... and β-actin (mouse; 1:5000; ORIGENE; #TA-09), followed by HRP conjugated secondary antibodies against rabbit or mouse IgG (1:5000 ...
-
bioRxiv - Cell Biology 2023Quote: ... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
bioRxiv - Plant Biology 2024Quote: ... The separated proteins were then subjected to immunoblotting using GST antibody (M20007L; Abmart; 1:5,000 dilution) and His antibody (F013; ORIGENE; 1:5,000 dilution) or MBP antibody (AE016 ...
-
bioRxiv - Immunology 2024Quote: ... and anti-murine TCR constant domain (FITC, CL075F, Origene, Rockville, MD, USA). TCR-T cells were tested for activation-induced cytolytic responses by coincubation with target cells (1:1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... OxtR protein expression was assessed by immunostaining with goat anti-rat OXTR antibody (1:100; Origene) and revealed with Alexa Fluor® 594 labeled rabbit anti-goat antibody (1:300 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers targeting beta-Actin (ACTB) (NM_001101) were obtained from Origene (Cat. No. HP204660) and included as the reference gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... Single cells were then expanded to larger culture volumes and were screened for a reduction in Foxc1 protein levels by immunoblotting with anti Foxc1 antibodies (Origene), followed by sequencing of the Foxc1 ORF ...
-
bioRxiv - Microbiology 2021Quote: ... MLV P30 protein within the pseudovirus capsid was detected using a rabbit anti-MLV-P30 polyclonal antibody (Origene, Cat. No. AP33447PU-N) and an HRP-conjugated goat anti-rabbit IgG Fc secondary antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then incubated with primary antibodies against green fluorescent protein (GFP, 1:500, Nacalai, 04404-84, RRID: AB_10013361) and tdTomato (1:500, OriGene, AB8181-200, RRID: AB_2722750) at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry recombinant protein (Origene, TP790040); D-biotin ...
-
bioRxiv - Cancer Biology 2024Quote: ... Recombinant (r) proteins rLOX (Origene), active rMMP-7 (Millipore ...
-
bioRxiv - Cancer Biology 2021Quote: ... and CDK6 proteins (Origene; 0.2 μg), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... or control recombinant protein CENPA (Origene) at 0.5 ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... NY-ESO-1 recombinant protein (Origene) at 0.5 ug/ml ...
-
bioRxiv - Physiology 2022Quote: Recombinant protein STK25 (0.5μM, TP303215, OriGene) and PRKAR1A (1μM ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein DHX36 was purchased from OriGene Technologies Inc ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were blocked with protein block (OriGene) for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... the Dendra2 protein was obtained from OriGene Technologies ...
-
bioRxiv - Immunology 2024Quote: ... recombinant AMPKγ protein (5µM; AR51158PU-S, OriGene) was mixed with 20µM of sestrin (Genetex) ...
-
bioRxiv - Microbiology 2020Quote: ... TRAF6 or MEKK3 proteins were purchased from Origene, as well as siRNA No Target ...
-
bioRxiv - Cell Biology 2022Quote: ... FGFR2-flag recombinant protein (Origene, Rockville, MD, USA) was added to the plate for adherence to the coated binding candidates ...
-
bioRxiv - Cell Biology 2023Quote: ... and NICD: Mdm2 (MDM2 protein Gln119-Leu438 Origene TP761916 ...
-
bioRxiv - Molecular Biology 2022Quote: HNRNPH1 full-length protein was purchased from OriGene Technologies (Rockville ...
-
bioRxiv - Developmental Biology 2024Quote: Human recombinant oviductin protein was obtained from Origene Technologies Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were purchased commercially: NOTCH1 (Origene, Cat# TP762041), CDH6 (ACROBiosystem ...
-
bioRxiv - Neuroscience 2023Quote: ... The protein standard for the assay was TP310606 (Origene). For the pSer129 α-synuclein assay ...
-
bioRxiv - Microbiology 2023Quote: ... MPXV A27L protein (OriGene Technologies, Inc BP1076, 1:1000), cleaved caspase-3 (arigo Biolaboratories Crop. ...
-
bioRxiv - Genetics 2022Quote: ... Purified NAT2 protein was purchased from OriGene (CAT#: TP761755). 2-amino-3-methylimidazo [4,5-f] quinoline (IQ ...
-
bioRxiv - Cancer Biology 2023Quote: ... biosensors were exposed to recombinant Arc protein (TP304129, OriGene) solution in the assay buffer at a concentration of 30 µg mL-1 of for 130 s ...
-
Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-viral hsa-miR-132 ProcessingbioRxiv - Molecular Biology 2024Quote: ... In vitro DICER assays with recombinant DICER protein (OriGene) were performed in 5 µl final reaction volume ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-SARS-CoV-2 Spike Protein was purchased from Origene Technologies Inc ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lactating mammary gland protein butyrophilin (BTN1A1) anti-BTN1A1 (mouse, OriGene Technologies ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Biochemistry 2022Quote: ... and PCYT1B (UniProt KB: Q811Q9) recombinant proteins were purchased from Origene. In bacterial expression plasmids for His6-tagged PCYT2β (Uniprot KB ...
-
bioRxiv - Cell Biology 2021Quote: ... The DNPEP and ENPEP proteins were purchased from OriGene (Cat#: TP300104) and Novus Biologicals (Cat# ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...