Labshake search
Citations for Origene Technologies :
51 - 100 of 254 citations for DnaJ Hsp40 Homolog Subfamily C Member 10 DNAJC10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... full length human RTEL1 was cloned into pLenti-C-myc-DDK-IRES-Puro (Origene) plasmid by digestion with AscI and MIuI and mutagenesis for RTEL1K48R was performed using QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent) ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... A nontargeting 29-mer scrambled shRNA cassette in pGFP-C-shLenti vector (TR30021, OriGene) served as a control ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA for mouse Btbd11 was purchased C-terminal Myc tag (Origene catalog number: MR217199). Using this cDNA as template pCAG-GFP-Btbd11 was generated ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse Climp-63 tagged with Myc-DDK in the C terminal (Origene Catalog: MR215622) was cloned in an Ad5 backbone from Vector BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... A 29-mer scrambled shRNA cassette in the pGFP-C-shLenti vector (TR30021; Origene) was used as the off-target control ...
-
bioRxiv - Cell Biology 2023Quote: ... The spectrin-silencing shRNA plasmids were constructed in the pRFP-C-RS backbone (Origene). These plasmids allow cloning and expression of shRNA under a U6 promoter and co-expression of the TurboRFP red fluorescent protein under the control of a CMV promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-C-Myc-DDK-P2A-Puro Lentiviral Gene Expression Vectors were acquired from Origene (NPEPPS RC209037L3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...
-
bioRxiv - Cancer Biology 2019Quote: ... pCMV6-Entry Tagged Cloning mammalian vector with C-terminal Myc-DDK Tag (Origene, CAT#: PS100001). TransIT®-LT1 (Mirus Bio LLC.) ...
-
bioRxiv - Microbiology 2021Quote: The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-Directed Mutagenesis Kit (Cat# 200521 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product and the plasmid pLenti-C-mGFP (# PS100071 OriGene Technologies, Rockville, MD, USA) were digested with Asc1 (#R0558L Bioconcept ...
-
bioRxiv - Microbiology 2023Quote: ... The pLenti-C-Myc-DDK-P2A-BSD and pCMV6-Entry-YTHDF2 were purchased from Origene. The specific variants were generated by site-directed mutagenesis in pCMV6-Entry-YTHDF2 using the QuikChange II site-directed mutagenesis kit ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with siRNAs (Origene 10 ng/uL) and stimulants (NGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fh1 antibody was purchased from Origene (TA500681), Myc antibody from Cell Signaling Technologies (18583S) ...
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used included Ki67 (ORIGENE, TA802544) and cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplicons were ligated into AscI and NotI digested pLENTI-C-mGFP (#PS100071, OriGene, Rockville, MD, USA) according to standard procedures ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV6-Entry containing the human SLC44A2 cDNA C-terminally fused to EGFP was purchased from OriGene. To introduce the rs2288904 SNP encoding a R154Q substitution ...
-
bioRxiv - Genetics 2020Quote: ... ACE2 with C-terminal GFP-tag (RG208442) and Myc-DDK tag (RC208442) were purchased from Origene. Empty vectors pMax-GFP (Lonza ...
-
bioRxiv - Physiology 2021Quote: ... with a myc-FLAG epitope tag on the C-terminus (MR223526, Origene Technologies, Rockville, MD, USA). The human full-length BACE1 or BACE2 cDNAs were expressed from the pcDNA3.1/myc-His expression vector (Invitrogen ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... and Ser5 and murine Ser4 that express a C-terminal FLAG tag were purchased from Origene, and the Ser1 ...
-
bioRxiv - Developmental Biology 2023Quote: The full-length ITFG1 with or without a C-terminal Myc tag (OriGene Technologies, Inc., RC204773) was cloned in the expression vector pcDNA3.3 or pRRL.sin.cPPT.SFFV/IRES-neo.WPRE ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (S142A) was cloned into pLenti-C-Myc-DDK-IRES-Puro Lentiviral Gene Expression Vector (OriGene). HEK293T cells were transfected using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... NM_018718.3) cloned in pcDNA3.1 vector with a C-terminal eGFP tag was procured from Origene (USA). The CEP41 cDNA was amplified and subcloned into a bacterial expression vector pET28a(+ ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected either with scramble SiRNA (10 nM) or MAS-1 SiRNA (10 nM) according to manufacturer’s instructions (Origene Technologies, Rockville, MD, USA). Two days after transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... or 10 μmol/L Sirt1 inhibitor sirtinol (Origene, Rockville, MD) for 24h ...
-
bioRxiv - Neuroscience 2021Quote: ... For knockdown experiments four pGFP-C-shLenti vectors containing different shRNAs against Skap2 (Origene; see Table 1) were applied and scrambled shRNA was used as control (OriGene ...
-
bioRxiv - Cancer Biology 2020Quote: A C-terminal Myc-DKK-tagged RNF43 ORF expression construct was purchased from Origene (Origene, Cat# RC214013) and verified by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Human SCAND1 (NM_033630) ORF clone with Myc-DDK C-terminal tag (RC200079) was purchased (Origene, Rockville, MD) and designated pCMV6-ScanD1-myc-Flag ...
-
bioRxiv - Pathology 2019Quote: ... N- and C-fragment were cloned into a lentiviral expression plasmid (Cat. No: PS100101, OriGene, Rockville, MD). For generating CRIPSR KO podocytes ...
-
bioRxiv - Cancer Biology 2020Quote: Three unique 27mer RELA human siRNA oligo dupliexes (SR304030A, B and C) were obtained from Origene (SR304030). Universal scrambled negative control siRNA duplex (SR30004 ...
-
bioRxiv - Genomics 2021Quote: Full length human CHD4 tagged at C-terminus with Flag/Myc construct was obtained from Origene (RC224232). Full-length human GATA4 cDNA was amplified with 5’ primer (ATTAGCGATCGCCATGTATCAG ...
-
bioRxiv - Microbiology 2022Quote: ... and p62 T269E/S272D-3x Flag were cloned into pLenti-C-Myc-DDK-IRES-Neo vector (Origene) using NEBuilder® HiFi DNA Assembly Master Mix per manufacturer’s instructions (New England BioLabs ...
-
bioRxiv - Pathology 2022Quote: ... or control empty plasmids (pLJM1-EGFP, Addgene 19319 and pLenti-C-Myc-DDK-P2A-Puro, Origene PS100092) using Lipofectamine 3000 and cultured for 48 h ...
-
bioRxiv - Cell Biology 2023Quote: ... EGFP was cloned at the C terminus of the coding sequence of Pitx2 isoform 1 (Origene; MR227617). Lentivirus particles were generated as previously described 69 ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids encoding mouse KvS subunits with C-terminal myc-DDK tags were obtained from Origene (Kv6.1 (MR223857); Kv6.4 (MR224440) ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...