Labshake search
Citations for Origene Technologies :
1 - 50 of 186 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: TMEM43 (Myc-DDK-tagged)-Human transmembrane protein 43 (TMEM43) (GenBank accession no. NM_024334.2) was purchased from OriGene (RC200998) and cloned into CMV-MCS-IRES2-EGFP vector using BglII/XmaI sites ...
-
bioRxiv - Biochemistry 2020Quote: ... The human doublecortin (DCX) and doublecortin-like kinases (DCLK1, DCLK2, and DCLK3) cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG ...
-
bioRxiv - Neuroscience 2019Quote: ... the BTB domain regions of each were PCRed from the original vectors from Origene, and then ligated into the pCMV6-Entry vector using HindIII and XhoI restriction enzymes ...
-
bioRxiv - Cell Biology 2020Quote: ... The coding sequence for the cytoplasmic domain of TLR4 was amplified from TLR4 cDNA from Origene (Rockville, MD) using the forward primer ...
-
bioRxiv - Cell Biology 2022Quote: ... The Trans-Golgi network (TGN)-targeted version was made in house by in-frame cloning of the GRIP domain of GolginA1 (pCMV6-KL5-GolginA1, Origene) at the C-terminal end of TEPACVV ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing the Tantalus domain and SLiM sequence by PCR amplification of the required coding region with insertion into pCMV6-AC-Myc-DDK (Origene, Rockville, MD, USA) using an In-Fusion HD Cloning Plus kit (Takara Bio ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids containing OGA (Origene cat # RC222411) or OGT (Origene cat # RC224481 ...
-
bioRxiv - Molecular Biology 2024Quote: ... wells containing 2 µg of human PLG (Origene) were incubated with 3 µg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfer plasmid containing the A20 insert was obtained from Origene (MR210582L4 ...
-
bioRxiv - Immunology 2022Quote: ... Plasmid containing human IL-12p35 cDNAs were obtained from Origene. One day before transfection ...
-
bioRxiv - Cancer Biology 2022Quote: A plasmid containing the hAHRWT sequence was purchased from Origene (RC209832). The Q383H point mutation was introduced with site-directed mutagenesis with forward primer cattgtaactcacagaccactaacagatg and reverse primer gttagtggtctgtgagttacaatgatataatc ...
-
bioRxiv - Genetics 2020Quote: Mouse expression plasmids containing cDNA encoding Rhbdf1 was obtained from OriGene. The Q5® Site-Directed Mutagenesis Kit was used to introduce site-specific mutations in the mouse Rhbdf1 plasmid according to the manufacturer’s instructions and confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... virus-containing supernatant was collected and concentrated using Lenti-Concentrator (OriGene), for minimum 2h at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using a cDNA containing human MSI2 obtained from OriGene (Rockville, MD) as a template ...
-
bioRxiv - Physiology 2021Quote: ... medium was replaced by serum-free OptiMEM and cells were transfected with Septin-7-specific shRNA constructs in retroviral pGFP-V-RS vectors (Origene, Cambridge, UK) using Lipofectamine 2000 transfection reagent ...
-
bioRxiv - Cell Biology 2021Quote: ... or kinase-inactive rHTRA1 containing an S328A mutation (500 ng Origene TP700208) for 18hrs at 37° ...
-
bioRxiv - Cell Biology 2020Quote: Expression vectors containing full length rat genes Snai2 and Prrx1 (Origene, Inc.) were introduced into the hybrid cell line HF by lipofection using Lipofectamine Plus reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395). The APOE3 ORF was amplified from APOE3-TurboGFP and subcloned into an mEmerald-N1 backbone via Gibson assembly using HiFi DNA Assembly Master mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... ORFs containing full length murine SEL1L or GAPDH were obtained from Origene and were maintained in pCMV6 expression vectors and included an in-frame C-terminal MYC tag ...
-
bioRxiv - Microbiology 2021Quote: RNA interference for ATG5 and ATG7 in HepG2 cells was performed according to the protocol of ATG5/7 Human shRNA Plasmid Kits (Origene, Rockville, MD, USA). HepG2 cells (1 × 106 ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Immunology 2021Quote: ... we used RUNX3 or RUNX2 human shRNA plasmid containing GFP reporter gene (Origene, Cat# ...
-
bioRxiv - Genomics 2019Quote: ... For the 5’ eQTL a 250 bp construct containing the rs17168486 SNP (Origene) was subcloned into the Firefly luciferase reporter vector pGL4.23 (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: One μg of a plasmid containing TCF4 cDNA (Origene, Cat# 2243345, Rockville, MD) was transfected into indicated prostate cancer cell lines on a 6-well plate ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA containing its ORF was inserted into the pCMV-MIR vector (OriGene) to result in pCMV-Aβ175-cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: ... DNA sequences containing mouse C4B (NM_009780.2, synthesized by Genescript) and human C4A (RC235329, Origene) were subcloned (InFusion Kit ...
-
bioRxiv - Genomics 2024Quote: ... a plasmid containing the sequences for NY-ESO-1 (CTAG1B) was ordered from OriGene Technologies ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus containing supernatant was concentrated 1:50 as described by the manufacturer (Origene, catalog # TR30026), flash frozen in liquid nitrogen and stored at −80°C ...
-
bioRxiv - Genomics 2021Quote: ... the CTCF cDNA was amplified from a pCMV6-Entry vector containing CTCF cDNA (Origene, RC202416), the AID-eGFP-2A-bls was amplified from pEN244-CTCF-AID[71-114]-eGFP-FRT-Blast-FRT (gift of Elphege Nora ...
-
bioRxiv - Immunology 2021Quote: A DNA plasmid containing full-length cDNA sequence with a Flag-Myc tag (Origene #RC221091) was verified by Sanger sequencing and used as template in T7-promoter-based in vitro transcription/translation reactions (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... The same plasmid containing non-specific shRNA was used as a control (OriGene RNAi, 0415). The cells were transfected using Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Each guide RNA was cloned into a plasmid containing Cas9-GFP (OriGene plasmid GE100018, Rockville, MD). Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV6-Entry containing the human SLC44A2 cDNA C-terminally fused to EGFP was purchased from OriGene. To introduce the rs2288904 SNP encoding a R154Q substitution ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid containing human Sirt3102-399 (pEX-His-hSIRT3102-399) was purchased from OriGene (Rockville, MD).
-
bioRxiv - Cell Biology 2021Quote: ... Expression plasmid containing Myc-DDK-tagged NDUFA11 cDNA was purchased from Origene (Origene, cat. no. RC208966) and pRK5-EGFP-MAPT was a gift from Karen Ashe (Addgene plasmid # 46904 ...
-
bioRxiv - Biochemistry 2023Quote: ... This ORF was then subcloned into a hygromycin resistance-containing pCMV6 entry vector (OriGene, CAT PS100024) and used to generate an LRPPRC-KO cell line reconstituted with a wild-type LRPPRC gene as reported 27 ...
-
bioRxiv - Systems Biology 2022Quote: ... lentivirus was generated as described above using plenti-CMV-Puro-DEST containing MORC3 (OriGene Technologies, RC210530) or SETDB1 (OriGene Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... Incubation with primary antibodies at 37°C for 1h included goat β-catenin antibody (cat# AB0095) from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fh1 antibody was purchased from Origene (TA500681), Myc antibody from Cell Signaling Technologies (18583S) ...
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...