Labshake search
Citations for Origene Technologies :
1 - 50 of 205 citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... or mouse MSS51-Myc-FLAG (mouse cDNA clone; Origene MR217897) using Lipofectamine 2000 as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Cell Biology 2021Quote: Mouse Igfbp3 cDNA (Origene) was amplified with attB-containing primers and cloned into pDONR 221 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse PRRX1 (Origene TA803116), rabbit YAP (Cell Signaling 14074) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Cancer Biology 2023Quote: ... mouse EDA-A2 (MC208415) and mouse OSM (MR226014) expression plasmids were purchased from Origene. Mouse NIK expression plasmid was purchased from Invivogen (pUNO1-mMap3k14) ...
-
A novel neural stem cell-derived immunocompetent mouse model of glioblastoma for preclinical studiesbioRxiv - Cancer Biology 2020Quote: ... mouse anti Bcat1 (TA504360, OriGene), mouse anti-GFAP (644701 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Turbo GFP (mouse; Origene).
-
bioRxiv - Microbiology 2022Quote: ... and mouse Cd164 (Origene, #MR201951) cDNAs were cloned into EcoRV-cut plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MIC19 (TA803454, Origene) at 1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LGALS9 (OTI19H8, Mouse monoclonal, Origene) at 1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-TurboGFP (TA150041, Origene), mouse anti-FLAG M2 (F1804 ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse Oprk1 (Origene, Rockville, USA) were grown in DMEM (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse-α-RFP (1:100, Origene), rat-α-Bcl11b (1:500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Molecular Biology 2022Quote: ... sharing 91% homology with mouse JPH2 protein) and mouse Jcn cDNA (Accession number: NM_133723, Origene, Rockville, MD, USA) were inserted into pVN155 and pVC155 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:100 mouse anti-β-catenin (Origene), 1:100 mouse anti-E-cadherin (Cell Signaling) ...
-
bioRxiv - Cell Biology 2020Quote: ... full length mouse CRMP4 (DPYSL3, Origene 1197294), full length CRMP5 (DPYSL5 ...
-
bioRxiv - Genomics 2021Quote: ... mouse anti-TurboGFP (1:250, Origene, TA150041) / rabbit anti-Flag (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-Flag (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-ChAT (Chemicon ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse AUTS2-myc-DDK in pCMV6 (OriGene) and pCGN-His-Ub (His-tagged ubiquitin expression vector ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse HSP90AB1 was purchased from Origene (TA500494). All antibodies were used at a dilution of 1:1000 unless otherwise specified ...