Labshake search
Citations for Origene Technologies :
301 - 350 of 480 citations for Anti CD25 SAP human Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... anti-Bcl-xL (clone 4A9, Origene), and β-tubulin (clone TU-06 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-CC10 (Origene, AM26360PU-N), Mouse-anti-CD63 (DSHB Hybridoma Product H5C6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-tGFP (1:1000 Origene, TA150041) GAPDH (1:2000 Millipore ...
-
bioRxiv - Physiology 2022Quote: ... anti-tGFP (TA150075, 1:500; Origene), anti-CoxIV (ab33985 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-K14 (1:300, Origene #BP5009) and anti-GFP (6 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-HK2 (TA325030, 1:500, Origene), anti-LDHA (3582T ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-NOTCH1 (Origene, EP1238Y, 1:200), anti-Foxn1 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2020Quote: ... and unconjugated anti-GFP (Origene TA150070), anti-mCherry (Novus NBP2-25158) ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-Adam10 (Origene, AP05830PU-N), mouse anti-Alix (Santa Cruz ...
-
bioRxiv - Genetics 2021Quote: ... chicken anti-GFAP (1:200, Origene). Secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... or anti-NEU4 (AP52856PU-N, Origene) antibodies as previously described.28 ...
-
bioRxiv - Immunology 2022Quote: ... 30 The anti-NEU3 (TA590228, Origene) was used at 0.5 µg/mL in PBS-BSA/500 mM NaCl/0.1% NP-40 alternative (EMD Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... anti ABHD17 (1:1000, Origene TA331704), anti ABHD17 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Nav1.7 (1:500, Origene, TA329033), anti-CCT5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CCT5 (1:1000, Origene, TA308298), and anti-TMED10 (1:1000 ...
-
bioRxiv - Genetics 2022Quote: ... and goat anti-KLF1 (Origene TA305808). The beads were retrieved using a magnetic stand and rinsed with RIPA buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit polyclonal anti-GFP (Origene, #TP401) and mouse monoclonal anti-GFP (clone B-2 ...
-
bioRxiv - Physiology 2023Quote: ... rabbit anti-beta tubulin (Origene, TA301569), goat anti-rabbit IgG (LI-COR Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA construct was generated by PCR-amplification on the pCMV6-XL5-human full-length SORL1 cDNA plasmid (pCMV6-XL5-WT-SorLAFL OriGene Technologies, Inc, Rockville, MD, USA) using the 5’ CCGGAATTCCGGCAAAATGGCGACACGGAGCAGCAGG 3’ and 5’ TGCTCTAGAGCACTACTCGTTCTCTTCTGCCAGGGG 3’ oligonucleotides ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Prx3 (Origene, TA322470, dilution 1:100) and anti-CERT (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... 1:100 mouse anti-β-catenin (Origene), 1:100 mouse anti-E-cadherin (Cell Signaling) ...
-
bioRxiv - Cell Biology 2021Quote: ... Goat anti-Rat IgG (OriGene Technologies, U.S.) and anti-Rab IgG secondary rabbit antibody (OriGene Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-ACAA2 (Origene Technologies, cat # TA506126). The slides were imaged using Nikon A1R laser scanning confocal microscope with Plan Apo 60x objective.
-
bioRxiv - Cancer Biology 2019Quote: ... For immunoblotting anti-DDK antibody (Origene TA50011) or (Ab2 ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mCherry (1:500, OriGene AB0081-500); anti-mKate2 for Brainbow 3.0 (gift of Dr ...
-
bioRxiv - Genomics 2021Quote: ... mouse anti-TurboGFP (1:250, Origene, TA150041) / rabbit anti-Flag (1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-Flag (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-Flag (Origene, TA50011, 1:1,000), goat anti-ChAT (Chemicon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-KRT8 (Origene, BP5075; 1:300). For secondary antibody incubation ...
-
bioRxiv - Immunology 2023Quote: ... and goat anti-TdTomato (AB8181-200, Origene). The following secondary antibodies were all from Jackson ImmunoResearch unless noted ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-CCT1 (1:200 dilution, Origene), mouse anti-CCT5 (1:200 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-TMED10 (1:1000, Origene, TA306375), overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Mouse anti ZFP36 (Origene #OTI3D10, 2μg/ml), rabbit anti ZFP36L1 (CST #BRF1/2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-GFP (catalog#TA150041, OriGene, Rockville, MD) at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-CSNK1G1 (IF: 1:50, OriGene, TA806333S); Anti-ROBO2 (IF ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-mCherry (Origene, Cat. No.: AB0040-200), Anti-calnexin (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Mouse anti-DsRd (1:500, TA180084, Origene), *Rabbit anti-DsRd (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... mouse anti-Lhx1 (CF504527, OriGene, RRID: AB_2724601) labeled with Alexa Fluorphore 647 (Novus ...
-
bioRxiv - Genetics 2024Quote: ... anti-DNA-PK (1:4000, Origene #TA314389), anti-Rabbit-IgG (1:2000 ...
-
bioRxiv - Genetics 2019Quote: A CrispR-Cas9 knockout kit (Origene, Rockville, MD) for mouse Kif26b (SKU KN308785) ...
-
bioRxiv - Cell Biology 2020Quote: ... the anti-TFAM (TA332462, rabbit; Origene, Rockville, USA) antibody was incubated in 5 molar excess of NHS-Alexa Fluor 546 (A20002 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-DDK (4C5) (OriGene Technologies, Rockville, MD). Alexa-594 labeled transferrin ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-RFP (1:1000, OriGene, AP09229PU-N), guinea pig anti-pSmad1/5/8 (1:300 ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-ERGIC-53 (clone 2B10, OriGene), rabbit polyclonal anti-ERGIC-53 (E1031 ...