Labshake search
Citations for Origene Technologies :
1 - 50 of 290 citations for 7 methoxy 4 piperidin 1 ium 1 ylmethyl 3 4 dihydro 2H 1 benzoxepin 5 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Neuroscience 2020Quote: ... tdTomato 4 μM (OriGene); Oregon Green 488 BAPTA-1 hexapotassium salt 45 μM (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... WIPI-4-TurboGFP (Origene; WDR45-tGFP transcript variant 1 ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared medium was supplemented with 1:5 Lenti Concentrator (OriGene, Rockville, MD, USA) and incubated 2-4 hours at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-HCRTR1 from rabbit (Origene Cat#TA328918; 1:100–1:500). Donkey IgG secondary antibodies coupled to Alexa-594 ...
-
bioRxiv - Neuroscience 2020Quote: ... NDUFAF1 (1:2,000, Origene), TOM20 (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μm-thick paraffin sections were deparaffinized and stained with anti-human KI67 (1:500, TA802544, Origene), anti-mouse Ki67 (1:800 ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Neuroscience 2020Quote: ... and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829, Origene, Rockville MD), using PCR primers to add flanking restriction sites ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-ZEB2 (Origene, TA802113, IF 1:150, WB 1:2000 in milk), sheep anti-TBR2 (R&D Systems ...
-
bioRxiv - Cell Biology 2020Quote: ... Overexpressed HA-NFATc3 and endogenous Trim39 were detected using anti-HA (1:500) and anti-Trim39 (from Proteintech 1:200, from Origene 1:400) antibodies respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... 5% heat-inactivated goat serum) and incubated with primary antibody (1:1000 anti-DDK monoclonal 4C5; OriGene Technologies) in PBT1 at 4°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lgr5 (1:200) (Origene, TA503316), Oct4 (1:200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LHX1 (OriGene #TA504528; 1:1000); LTL-Biotinylated (Vectorlabs B-1325 ...
-
bioRxiv - Molecular Biology 2022Quote: ... tGFP (1:200 Origene, TA150041), ki67 (Medac 275R-18) ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... β actin (Origene, TA811000, 1:5000), GAPDH (Origene ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... GAPDH (Origene, TA802519, 1:5000), PCNA (BOSTER Biological Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tff1 (OriGene, TA322883 1:100), Tff2 (Proteintech ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:1000), Mpz (AvesLab ...
-
bioRxiv - Developmental Biology 2022Quote: ... K14 (OriGene, #BP5009, 1:1000), Involucrin (Biolegend ...
-
bioRxiv - Cell Biology 2020Quote: ... tdTomato (1:200, TA180009, OriGene), HuNu (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mcam (Origene, rabbit 1:200), Mpz (AvesLab ...
-
bioRxiv - Cancer Biology 2020Quote: ... ANXA11 (OriGene, 1/100 dilution), PPP1R12A (Invitrogen ...