Labshake search
Citations for Origene Technologies :
301 - 321 of 321 citations for 7 chloro 1 2 diethylamino ethyl 5 2 fluorophenyl 1 3 dihydro 2H benzo 1 4 diazepin 2 one monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a human GAB1 3′-UTR reporter plasmid (containing 3770 bp immediately downstream of the end of the GAB1 ORF cloned into pMirTarget, Origene), a control Renilla luciferase plasmid (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... wells were blocked with 1% BSA diluted in PBS for 30 min at 37 °C and increasing amounts (0 μg to 3 μg) of PLG (Origene) diluted in blocking solution were added to the wells and incubated for 1 hour at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: The BAP1 RNA knockdown was performed with a set of 3 unique 27-mer siRNA duplexes targeting BAP1 (Origene, SR305435) using siTrans 1.0 (Origene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Cell Biology 2022Quote: ... For protein-protein interaction experiments using the pCMV6 vector with HA or Myc-DDK peptide tag at the 3’-end (Origene Technologies), we used the same IF cloning system to subclone cDNAs of our genes-of-interests (GOIs ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... [TL51074CB 5’ –AGACCGTAAACGCTATCAGCAAGAAGTAG] are in the plasmid backbone pGFP-C-shLenti and were from Origene (Rockville, MD). The non-targeting shRNA control ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2021Quote: ... the gene encoding for green fluorescent protein (GFP) and the 3’UTR of the Cpt1a gene were cloned into a unique EcoRI site of pBS31 vector (OriGene Technologies, Rockville, Maryland). This vector contains the phosphoglycerate kinase (PGK ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well received 100 ng of the pMIR-REPORT™ Luciferase vector containing the 3’UTR-hTLR4 (without a negative control) in combination with 1µg pCMV-MIR or pCMV-pre-mir125b1 (OriGene Technologies, Rockville, Maryland, USA) or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Microbiology 2022Quote: ... Two 0.5 ml aliquots of the supernatant were then mixed with 5 μg of bead-immobilized anti-basigin (Origene TA501189) and anti-neuroplastin (R&D Systems AF7818 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable knockdown of FTO was achieved by lentiviral delivery (5 D.O.I) of anti-FTO sh-RNA (Origene, #TL308064, sh-FTO#B). Isolation of infected cells was performed by GFP positive cells sorting on FACSAria.
-
bioRxiv - Immunology 2020Quote: ... paraffin-embedded serial sections (5 μm) first underwent standard deparaffinization and rehydration procedures and were then probed with GHRHR (Origene, cat # TA311715) as primary antibody ...