Labshake search
Citations for Origene Technologies :
1 - 50 of 306 citations for 7 Oxabicyclo 4.1.0 hepta 2 4 diene 1 3 4 trifluoro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Neuroscience 2020Quote: ... tdTomato 4 μM (OriGene); Oregon Green 488 BAPTA-1 hexapotassium salt 45 μM (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... WIPI-4-TurboGFP (Origene; WDR45-tGFP transcript variant 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmids containing human TIM-1 and human TIM-4 were obtained from Origene. For expression of extracellular regions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Coverslips were then incubated overnight at 4 °C with EWS (Origene, 1:200) and pH2AX (CST ...
-
bioRxiv - Cell Biology 2020Quote: ... then fixed with 4% PFA and stained with 1:5000 rabbit anti-EGFP (Origene) and anti-rabbit AF647 (10μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... Blots were blocked for 1 hour at room temperature with 2% BSA diluted in PBST and incubated overnight at 4 °C with 25 μg/ml of PLG (Origene) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by incubation overnight at 4°C with primary antibodies against GFP (1:100, TP401; OriGene Technologies) (Fig 1B) ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then incubated overnight at 4°C with a mouse monoclonal anti-mCherry antibody (Origene; 1:1500) diluted in 5% milk in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... and dipeptidyl peptidase-4 (DPP4) cDNA clones were obtained from Origene, and cloned into a pcDNA3 vector (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... pLKO.1-puro or pLKO.1 plasmids encoding target shRNA constructs (Supplemental Table 4; selected from TRC shRNA Library, Broad; purchased from Origene) were cloned as previously described ...
-
bioRxiv - Genetics 2023Quote: ... Sections were incubated overnight at 4 °C with an anti-Cnn1 rabbit monoclonal primary antibody (1:400 dilution; TA327614; Origene), or a CD68 rabbit polyclonal antibody (1:300 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were incubated with the following primary antibodies overnight at 4°C: mouse anti-DPP9 (Origene, TA503937, 1:1000). After three washes with TBST ...
-
bioRxiv - Microbiology 2022Quote: ... were coated with various concentrations of purified recombinant caspase-4 (Origene, TP760359) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Genetics 2020Quote: ... 10 μg of plasmid DNA (4 variants of shRNA carrying plasmids, OriGene TL501619) DNA was used to transfect one plate ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4 °C using a rabbit polyclonal anti-GLP-1R antibody (1:50; Origene, Rockville, MD, USA, TA336864). Specificity of GLP-1R antiserum has been previously described in detail [21–23] ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with a set of 4 shRNAs against Spry4 (OriGene, cat.#HC108594) or shRNA negative control (OriGene ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were stablished transducing cells with a set of 4 shRNAs against Mdm2 (Origene, cat.#TL311529) or shRNA negative control (Origene ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-cleaved Caspase-3 (9661S, CST, 1:500) and anti-Flag (TA-50011-100; Origene, 1:500). Cells were washed with PBS and incubated with secondary antibodies (Jackson Immunoresearch Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... Control or CGGBP1-shmiR (targeting 4 different regions in CGGBP1 ORF) or CGGBP1-overexpression lentivirus constructs were obtained from Origene. The third generation lenti-packaging plasmids ...
-
bioRxiv - Biochemistry 2021Quote: ... Expression constructs encoding Myc-Flag-tagged (C- end) mouse CNNM1-4 and ARL15 in the pCMV6-Entry expression vector were acquired from OriGene (MR218318 for CNNM1 ...
-
bioRxiv - Plant Biology 2023Quote: ... overnight at 4°C (anti-PsbA; AS05 084A; anti-PsaB; AS10 695; anti-APC; AS08 277; Agrisera, anti-His tag; TA150087; OriGene). The membrane was washed 3 times in TBST-T at room temperature for 15 minutes each wash followed by incubation with secondary polyclonal anti-rabbit antisera HRP for one hour at room temperature in TBS-T (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sections were then incubated overnight at 4 °C with one of the following primary antibodies: rabbit polyclonal anti-mGFP (TA150122, OriGene, USA), mouse anti-hNuclei ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μl Lipofectamine 2000 was mixed with 1 μg of each HA-ZNF804A (Origene, RG211363) or Myc-NT5C2 (Origene ...
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Neuroscience 2020Quote: ... and C and Nuak kinases 1 and 2 were purchased from OriGene Technologies ...
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... A primary mouse monoclonal Lysyl Hydroxylase 2 (LH2) antibody (Origene; Cat# TA803224, dilution 1:150) was used for the immunohistochemical staining.
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Physiology 2019Quote: ... NRVMs (1 – 3 days post isolation) were transiently transfected with either variant 8 of human BIN1 (AmpII) (Origene Inc, USA) cloned into pCMV6-AC-mKate2 entry vector (Origene Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...