Labshake search
Citations for Origene Technologies :
301 - 318 of 318 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 0.64 μg of pMD2G-VSVG and 0.64 μg of pspAX.2 using transfecting reagent Megatran 1.0 (Origene).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG87.TRKB cells were transfected with a mix of 4 AP2M specific shRNA sequences (#TG712191, Origene, USA or scrambled sequence as control) using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells expressing shMdm2 or shScramble were sorted for GFP positive cells and transduced with lentivirus carrying a pool of shRNAs against Sprouty4 (4 different shRNAs purchased from OriGene, cat.#HC108594) or shScramble sequence as control (OriGene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HT1080 p53KO cells were transduced with lentivirus carrying a pool of shRNAs against Mdm2 (4 different shRNAs purchased from OriGene, cat.#TL311529) or shScramble sequence as control (OriGene ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAi was performed by transfecting cells 2 days before synchronization at 20% confluence with 5 nM siRNA (scrambled sequence, two different sequences against PARP1 and TRF1: PARP1 siRNA Origene SR300098B/C, TRF1 siRNA Origene SR322000B/C ...
-
bioRxiv - Microbiology 2022Quote: ... Two 0.5 ml aliquots of the supernatant were then mixed with 5 μg of bead-immobilized anti-basigin (Origene TA501189) and anti-neuroplastin (R&D Systems AF7818 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable knockdown of FTO was achieved by lentiviral delivery (5 D.O.I) of anti-FTO sh-RNA (Origene, #TL308064, sh-FTO#B). Isolation of infected cells was performed by GFP positive cells sorting on FACSAria.
-
bioRxiv - Immunology 2021Quote: ... HAP1 cells were transfected with 2 µg lentiCRISPR v2 bearing the sgRNA of interest in the presence of transfection reagent Turbofectin 8.0 (OriGene). Transfected cells were selected with 2 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Cancer Biology 2019Quote: ... CRISPR/Cas9 plasmid at 2 μg concentration was transfected by Turbofectin 8.0 following the protocol from OriGene (Rockville, MD).
-
bioRxiv - Immunology 2020Quote: ... paraffin-embedded serial sections (5 μm) first underwent standard deparaffinization and rehydration procedures and were then probed with GHRHR (Origene, cat # TA311715) as primary antibody ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: HEK-null2 cells were transfected with a human TLR4 expression clone (pcDNA3-TLR4-YFP was a gift from Doug Golenbock – http://n2t.net/addgene:13018) and human MD-2 expression clone (Origene; RC204686) to assess cytokine secretion in response to TLR4 agonist treatments ...
-
bioRxiv - Genetics 2022Quote: ... DAB staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... ATAGAGCGTGCGGATAATGACAAGGAGTA), Synaptojanin 2 shRNA in pRFP-C-RS vector (cat. no. FI732825, TGTGCCTCTGCGGCAGCACCAGGTGAACT and FI732826, TTGTGGAGACAGAGCAGGCGATTTACATG) were purchased from Origene. Constructs of the following proteins were kind gifts ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Neuroscience 2020Quote: CaMKIIα and calmodulin expression in Drosophila cells was accomplished as follows: CaMKIIα and calmodulin coding sequences were copied from human cDNA clones CAMK2A transcript variant 2 (catalog SC109000, Origene, Rockville MD) and CALM1 Human calmodulin 1 transcript variant 1 (catalog SC115829 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Nrf2 was knocked-down by RNA interference (RNAi) using the following 19-bp (including a 2-deoxynucleotide overhang) siRNAs (Origene, Beijing, China): Nrf2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... staining was performed using Polink-2 Plus HRP Polymer and AP Polymer detection for Rb antibody kit (D39-18, Origene, Washington, USA) following manufacturer’s instructions ...